2000 Pacific Division Meeting Abstracts
(Joint with Canadian Phytopathological Society)
June 18-21, 2000 - Victoria, BC, Canada

Posted online August 7, 2000

Effect of paclobutrazol on growth, yield and anatomical structure of peanut plant infected with pod and root rot pathogens. M. E. Abdalla. Department of Plant Pathology, Faculty of Agric., Mansoura University, EL-Mansoura 35516, Egypt. Publication no. P-2000-0001-PCA.

Paclobutrazol (PBz), a triazole compound was applied to peanut at 250 and 500 ppm. PBz decreased plant height but increased shoot dry weight, number of branches and pegs per plant, 100 pod weight and 100 seed weight(g). Soil infested with either Fusarium solani or Rhizoctonia solani reduced all above mentioned parameters. R. solani was more virulent than F. solani on plant growth and yield. Within treatments of interaction between PBz and each pathogen, the highest reduction of disease incidence was found in plants grown in infested plots and received 500 ppm of PBz followed by 250 ppm level. Anatomically, the most striking changes occurred in the infected stem and carpophore were complete destruction of the epidermis, plasmolysis in the cortex and degradation of the primary cell walls. Also, breakdown of cell component was found in some regions of pod shell and the cotyledons.

Tritrophic interactions in a biological control system. Y.-S. Bae and G. R. Knudsen. Publication no. P-2000-0002-PCA.

A fungivorous nematode, Aphelenchoides sp., was isolated by baiting field soil with mycelium of Trichoderma harzianum ThzID1, and subsequently was maintained on agar cultures of the fungus. Interactions between the nematode and the GFP transformant ThzID1-M3 were investigated using both heat-treated (80 C, 30 min) and untreated field soil; ThzID1-M3 was identified in soil by epifluorescence microscopy. When ThzID1-M3 was added to soil as an alginate pellet formulation, addition of the nematode (10 per g) significantly reduced both radial growth and recoverable populations of the fungus; this effect was greater in heat-treated soil. Addition of ThzID1-M3 to soil pre-treated with the nematode (10 per g) stimulated nematode population growth for approximately 10-20 days, whereas nematode populations decreased in the absence of added Trichoderma. Addition of ThzID1-M3 to untreated soil also resulted in an increase in numbers of indigenous nematodes. When sclerotia of Sclerotinia sclerotiorum were added to soil (10 per 200 g) with ThzID1-M3 (40 pellets per 200 g), addition of Aphelenchoides sp. reduced the number of sclerotia colonized by ThzID1-M3. These results suggest that fungivorous nematodes may be a significant biotic constraint on activity of biocontrol fungi in the field.

Genetic markers for identification, estimation of infection, and risk assessment of Chondrostereum purpureum, a biological control agent for forest weeds. E. M. BECKER (1), R. L. Hahn (1), P.de la Bastide (1), S. F. Shamoun (2), and W. E. Hintz. Publication no. P-2000-0003-PCA.

The indigenous fungus Chondrostereum purpureum is a promising biocontrol agent for several deciduous forest weeds of reforestation sites and utility rights-of-way. The formulated fungus is applied as a stump treatment to target weeds, and subsequently suppresses vegetative re-sprouting. We have developed a series of molecular markers for C. purpureum. An isolate-specific primer pair was developed according to a region (SCAR) of a RAPD fragment, which amplifies repetitive polymorphic DNA from C. purpureum. Banding patterns produced using these primers are distinctive and allow individual genotypes to be distinguished. To support the research and development of this biocontrol agent, we have successfully applied these genetic markers to the investigation of several aspects of this system including: the population diversity and dynamics (gene flow) of the fungus, the frequency of infection of treated stumps, the environmental fate and persistance of specific biocontrol isolates, and the genetic stability of the formulated product. These studies have furthermore enabled an assessment of the relative risks of deployment of one genetic individual of C. purpureum as a biocontrol agent of forest weeds in North America.

Studies on bacterial antagonists of post harvest pathogens of apple. K. E. BEDFORD (1), P. L. Sholberg (1), and S. L. Probert (1). (1) Pacific Agri-Food Research Centre, Agriculture and Agri-Food Canada, Summerland, BC V0H 1Z0. Publication no. P-2000-0004-PCA.

A series of post harvest experiments on apple, testing various bacterial isolates as antagonists, against the post harvest pathogens Penicillium expansum and Botrytis cinerea were conducted in 1999. One of the bacterial strains, a Pseudomonas sp. (1100-6) proved consistently effective against each of the post harvest pathogens on several different apple cultivars. The 1100-6 strain significantly reduced or completely inhibited post harvest rot at 5°C and 20°C, in air storage and under controlled atmospheric conditions. The antagonist was effective at various concentrations (10(^4), 10(^5), 10(^6) CFU/ml) against concentrations of the post harvest pathogens of 10(^5) and 10(^6) conidia/ml and could be applied as a dip. A period of time (24 h) after dip or wound inoculation with the antagonist before challenging with the pathogen greatly increased the effectiveness of the antagonist. Larger scale storage experiments using 1100-6 were established in the autumn of 1999.

Monitoring Aspergillus flavus AF36 and S strain incidence in the Desert Southwest. D. M. BIGELOW (1), T. V. Orum (1), P. J. Cotty (2), and M. R. Nelson (1). (1) Department of Plant Pathology, University of Arizona, Tucson, AZ 85721; (2) Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, New Orleans, LA 70179. Publication no. P-2000-0005-PCA.

Aflatoxin contamination of cottonseed causes significant economic loss for Arizona farmers because it prevents access to premium markets for their crop. Aspergillus flavus, the cause of aflatoxin contamination of cottonseed, can be divided into the S and L strains based on sclerotial morphology. S strain isolates are highly toxigenic whereas L strain isolates are variable in aflatoxin production. Some L strain A. flavus isolates produce no aflatoxin. An atoxigenic L strain of A. flavus (AF36), occurring naturally in Arizona, is currently part of an aflatoxin management program. In 1999, ten sentinel sites distant from AF36 treatment areas were chosen to develop baseline data on statewide AF36 incidence. Over 1200 isolates were characterized as S or L strain. The L strain isolates were tested for vegetative compatibility to AF36. AF36 was detected at eight sentinel sites from Brawley, CA to Safford, AZ (540 km). AF36 incidence in individual fields ranged from 0 to 7.3%. S strain incidence at the sentinel sites was combined with data from 1998 to develop a statewide map estimating S strain incidence prior to initiation of the management program. These data suggest that S strain incidence is inversely correlated with elevation in Arizona.

Phenazine biosynthesis in Pseudomonas aureofaciens is regulated by RpoS in a nutrient-dependent manner. F. M. BLACHERE and L. S. Pierson III. Department of Plant Pathology, University of Arizona, Tucson, Arizona, 85721. Publication no. P-2000-0006-PCA.

Pseudomonas aureofaciens strain 30-84 is a rhizosphere-colonizing biocontrol bacterium. Production of phenazine antibiotics by strain 30-84 suppresses the fungus Gaeumannomyces graminis var. tritici, the causal agent of take-all in wheat. Induction of phenazine gene expression is dependent upon a complex signal transduction cascade, including a two-component sensory system, an AHL quorum sensing system, and the stationary sigma factor RpoS. Mutation of rpoS results in differential production of the AHL signal required for phenazine gene expression. Under nutrient-limited conditions, AHL signal and phenazines are not produced in a rpoS mutant. The addition of exogenous AHL restores phenazine expression. Likewise, supplementation of nutrient-limited conditions with casamino acids or the AHL intermediate AdoMet restores phenazine gene expression. These results suggest a model in which RpoS affects substrate flow to the AHL synthase thus altering the levels of AHL signal and phenazine expression.

Spur blight as a foliar disease on fruiting canes of red raspberry. P. R. BRISTOW, G. E. Windom, and G. W. Menzies. Department of Plant Pathology, Washington State University, Puyallup 98371. Publication no. P-2000-0007-PCA.

Spur blight (Didymella applanata) on red raspberry normally causes diagnostic wedge-shaped lesions on leaves of primocanes and cane lesions around nodes with infected leaves. In 1997 and 1998, years with high rainfall in May and June, the fungus caused leaf-spotting and defoliation of leaves on laterals of fruiting canes. Spots began (late May) as scattered yellow areas associated with veins. The center of the spots became necrotic as the spots enlarged. Lesions coalesced and defoliation started by mid June; a time when green berries are a strong sink for photosynthates. Leaf damage was markedly reduced when plants were protected by a mixture of Captan + Rovral between early May and mid June, but not afterward. Ascospores of D. applanata were trapped between mid April and late July. Damage to leaves on laterals is usually not seen because fungicides applied during May and June for control of Botrytis fruit rot also protect leaves from D. applanata.

Nuclear condition and conjugation of basidiospores as taxonomic characters in Tilletia. L. M. CARRIS and P. M. Gray. Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430. Publication no. P-2000-0008-PCA.

Identification of Tilletia species traditionally has relied on teliospore morphology and host genus. Specimens with spores of similar size, color and ornamentation infecting hosts in the same genus are considered one species. However, taxonomically informative characters also are found in germinating teliospores and primary basidiospores, in particular basidiospore shape, size, conjugation and nuclear condition. We studied collections of T. lolii infecting different species of Lolium and identified two distinct taxa based on differences in basidiospore morphology and conjugation. An unusual nuclear variant was found in two Australian collections from L. perenne. Teliospores germinated to form 24-40 uninucleate, non-conjugating basidiospores, and colonies derived from single basidiospores formed teliospores in culture. Lolium plants inoculated with cultures derived from single basidiospores developed sori in infected florets. The implications of variations in nuclear behavior for the biology and systematics of Tilletia and allied genera will be discussed.

Influence of K/N and pH levels on resistance of two greenhouse pepper cultivars to Fusarium solani and Erwinia carotovora pv. carotovora. R. F. CERKAUSKAS and J. Brown. Agriculture & Agri-Food Canada, Greenhouse & Processing Crops Research Centre, Harrow, Ontario, N0R 1G0. Publication no. P-2000-0009-PCA.

The effect of three K:N ratios at 300:300, 400:200, and 480:120 (ppm), and three pH levels (5,6,7) on disease development of two pepper cvs. (Cubico and Edison) to Fusarium solani (F.s.) and Erwinia carotovora pv. carotovora (E.c.c.) was investigated in two separate trials in a double-poly greenhouse using an open rockwool slab system. The other constituents of the base feed were: P=50, Ca=150, Mg=50, Fe=1.2, Mn=0.65, and S=150 to 400, with S=200 ppm for the pH trial. Three pepper plants/m2 each with 2 stems, and 3 pepper plants per rockwool slab were used. Each 132 day-old (approx.) plant in the slab was inoculated at the second node above each of the two main stems with one of the treatments: F.s., E.c.c., or control-check. External and internal stem discolouration were measured 20 and 52 days after inoculation, respectively; visual symptoms were then assessed (0 = healthy, 5 = dead branch). There was no suppression of F.s. or E.c.c. symptoms by K:N or pH levels. Symptoms due to F.s. were more severe than those of E.c.c. in both cases. Cultivar yield response to K:N and pH levels was generally similar. K:N at 480:120 ppm gave the highest yield. The influence of Ca levels (100, 200, 300 ppm) will also be discussed.

Bacterial stem and peduncle canker of greenhouse pepper. R. F. CERKAUSKAS and J. Brown. Agriculture & Agri-Food Canada, Greenhouse & Processing Crops Research Centre, Harrow, Ontario, N0R 1G0. Publication no. P-2000-0010-PCA.

Disease losses to Erwinia carotovora pv. carotovora (E.c.c.),were 12% and 20% in 1996 and 1998, respectively, in greenhouse peppers at St. David's, Ont. The disease was also observed on field peppers near Harrow in 1996-97. Symptoms consisted of dark brown to black cankers on the stem nodes and fruit peduncles, dark discolouration of the internal stem tissue, and internal breakdown of the pith, and stem hollowness in some cases. Extensive bacteriological tests (Ref. Schaad, 1988) were conducted with all isolates to verify identity. Reactions of greenhouse and field strains were generally similar with a few exceptions. Spraying, spraying + (wounding or rubbing), and stem inoculation were conducted with the isolates. 'Early California Wonder' pepper plants that were wounded and then sprayed with a bacterial suspension consistently showed extensive collapse of stems and death of plants 4 days later regardless of isolate used. 'Trust' tomato plants showed a similar response in some cases or internal brown stem discolouration and hollowness in other cases. Spraying or spraying + rubbing of leaves with the isolates also caused extensive disease development but fewer plants were affected. Greenhouse and field isolates caused similar symptoms on both hosts. This is the first report in Canada.

Susceptibility of intermountain provenances of Douglas-fir to Rhabdocline needle cast. G. A. CHASTAGNER. Department of Plant Pathology, Washington State University, Puyallup, WA 98371. Publication no. P-2000-0011-PCA.

Intermountain (IM) forms of Douglas-fir have better postharvest moisture retention and are less likely to be injured by exposure to subfreezing temperatures than the coastal types traditionally grown as Christmas trees in the Pacific Northwest (PNW). However, planting IM Douglas-fir in the coastal areas of the PNW is currently not recommended because of their high susceptibility to Rhabdocline needle cast. During the past three years, needle cast severity was rated (0 to 100 scale) on trees in a replicated 1991 planting of IM Douglas-fir at WSU-Puyallup. In 1997, needle cast ratings ranged from 0.8 to 70. Trees from the Cibola National Forest (NF) had significantly higher needle cast ratings (70.0) than trees from Carson NF (17.3), Coconino NF (15.7), Rio Grande NF (5.0) and Upper Clearwater, ID (0.8). Trees from the Apache NF (51.4), San Isabel NF (32.3), two collections representing the Lincoln NF (25.4-30.2) and the Santa Fe NF (21.3) had intermediate levels of needle cast. Applications of chlorothalonil to the new growth in the spring have been highly effective in controlling needle cast on all of the provenances.

Use of the RGAP markers to detect stripe rust resistance genes in wheat germplasm. X. M. CHEN, Z. X. Shi, and R. F. Line. USDA-ARS and Washington State University, Pullman, WA 99164. Publication no. P-2000-0012-PCA.

The resistance gene analog polymorphism (RGAP) technique was used to identify markers for wheat resistance to stripe rust (Puccinia striiformis f. sp. tritici). Unique RGAP markers were identified for near isogenic lines with Yr1, Yr5, Yr7, Yr8, Yr9, Yr10, Yr15, Yr17, and YrA. Co-segregation of markers with Yr9 was confirmed with BC(7):F(2) and BC(7):F(3) generations of the cross between the Yr9 line and the recurrent parent. The location of Yr9 on chromosome 1B was confirmed by analyzing the nulli-tetrasomic and ditelosomic lines of Chinese Spring with co-dominant RGAP markers. The Yr9 markers were also detected in five wheat cultivars that have Yr9. To map quantitative trait loci (QTL) for durable, high-temperature, adult-plant (HTAP) resistance, the F(7) lines of Stephens/Michigan Amber were evaluated for resistance in field plots. Molecular markers were identified by amplifying the F(8) DNA with RGA primers. Resistance QTL that explained the most of variation were mapped on a linkage group consisting of 10 RGAP markers. These results show that the RGAP technique can be used to identify resistance genes in germplasm and may be used to combine resistance genes.

Powdery mildew induced expression of a peroxidase gene in Triticum aestivum L. D. W. Cheng, K. Armstrong, and G. Fedak. Eastern Cereal and Oilseed Research Center Agriculture and Agri-Food Canada, 960 Carling Avenue, Ottawa, Ontario K1A 0C6, Canada. Publication no. P-2000-0013-PCA.

Peroxidases are believed to be involved in several plant defense responses. Our previous research indicated that the induction of plant peroxidases appears to be an early event in these responses. Recently, we cloned a set of peroxidase (pxc) alleles from two wheat (Triticum aestivum L.) cultivars, Ac Dexter (resistant) and Absolvent (susceptible) to the powdery mildew pathogen (Erysiphe graminis f. sp.tritici). The molecular structures of the pxc alleles are highly diverged in the promoter region, but highly conserved in the ORF region which contains a signal peptide sequence at the 5' end of the coding domain, and 3 exons and 2 introns in almost the same position. Upon inoculation of one-month-old plants with a spore suspension of the powdery mildew pathogen and physical treatment of the leaves by wounding, the temporal relationship of the splicing/editing of the pxc gene and the resistance to the pathogen was examined in pxc transcripts by sequence analysis of cDNAs derived from leaves. It has been shown that the powdery mildew pathogen induced the specific expression of the pxc gene in the leaves of both cultivars. However, only the larger size transcripts induced by the pathogen in the resistant cultivar showed correct splicing and editing and produced a functional translation product. These results indicate that the peroxidase gene is inducible upon inoculation of plants with powdery mildew pathogen, pre-mRNA splicing and editing is required to produce structurally correct and functionally active peroxidase proteins in the resistance plants of common wheat.

Dehydrated garlic powder used to reduce Sclerotium cepivorum in field soil. F. CROWE (1), M. Davis (2), J. Nunez (3), R. Smith (4), and T. Darnell (5). (1) Oregon St. Univ., Madras OR 97741, (2) Univ. of California, Davis CA 95616, (3) Univ. Calif. Coop. Ext., Bakersfield CA 93307, (4) UCCE, Salinas CA 93901, and (5) OSU Coop. Ext., Milton-Freewater 97862. Publication no. P-2000-0014-PCA.

For single applications distributed within the infested depth of soil in large field plots, 0, 18.5, 37, 74, 111, 148, and 185 g/m(^3) of food-grade dehydrated garlic powder (DGP) lowered populations of Sclerotium cepivorum by 0-27, 33-77, 65-72, 92-95, 93-98, 94-98, and 100%, respectively, when applied within the optimal range of soil temperature and moisture for sclerotial germination. Data were composited from field trials near Walla Walla WA (1991-92, fall applied), Bakersfield CA and Hollister CA (1998, spring applied), and Madras OR (1999, spring applied). As per previous reports, >5 L/H diallyl disulfide (Madras and Bakersfield) or 200 kg/H tarped methyl bromide (Bakersfield) reduced populations by about 98%. DGP was obtained from California processors and used within a few months of production, but amount and composition of germination stimulants were not assessed. For white rot control, all such treatments should be adjusted to the depth to which sclerotia have been tilled.

Susceptibility of five nightshade (Solanum) species to Phytophthora infestans. L. M. Dandurand and C. V. Eberlein. Publication no. P-2000-0015-PCA.

Susceptibility of leaves and berries of six nightshade species to infection by Phytophthora infestans was tested. American black (S. americanum Mill) and eastern black (S. ptycanthum Dun.) nightshade were resistant to late blight infection. However, two biotypes of hairy (S. sarrachoides Sendtner) nightshade (smooth- and wavy-edged leaf), cutleaf (S. triflorum Nutt.), and bitter (S. dulcamara L.) nightshade were susceptible. Survival of the fungus in susceptible species was tested under various environmental conditions. The fungus survived for at least two weeks in both hairy nightshade biotypes when plant material was kept in soil at a temperature of 20°C. However, the fungus survived 48 hrs at -15°C only in the smooth-leaf hairy nightshade biotype. In the laboratory, oospores of the pathogen were formed in the two hairy nightshade biotypes, cutleaf nightshade, and 'Russet Burbank' potato, but not in American black, bitter, or eastern black nightshade.

The application of in vitro culture of western hemlock dwarf mistletoe to studies on biological control. S. J. DEEKS (1), S. F. Shamoun (2) and Z. K. Punja (1). (1) Dept. of Biological Sciences, Simon Fraser University, Burnaby, BC V5A 1S6; (2) Canadian Forest Service, Pacific Forestry Centre, Victoria, BC V8Z 1M5. Publication no. P-2000-0016-PCA.

Western hemlock dwarf mistletoe (Arceuthobium tsugense subsp. tsugense) is a parasitic plant that attacks western hemlock (Tsuga heterophylla) on the west coast of British Columbia. A novel study on the in vitro culture of this species was conducted, evaluating the effects of media, temperatures, presence or absence of light, and plant growth regulators on the production of radicles, holdfasts, and callus. Germinated seeds and calli were used in an in vitro screening method to test two potential biocontrol fungi, namely Cylindrocarpon cylindroides and Colletotrichum gloeosporioides. Infected mistletoe tissues were examined by light microscopy, and the process of pathogenesis was investigated. Cushion development, cell wall degradation, and inter and intracellular colonization were evident for germinated seeds, and growth of dwarf mistletoe callus was reduced. The in vitro screening method was useful to elucidate the host-pathogen interactions and determine the pathogenicity of the biocontrol fungi.

Detecting expression of a beet leafhopper transmitted virescence agent Phytoplasma plasmid with sequence specific oligonucleotides using RT-PCR. S. Diaz de Leon and M. Shaw. Department of Life Sciences, New Mexico Highlands University, Las Vegas, New Mexico 87701, USA. Publication no. P-2000-0017-PCA.

The Beet Leafhopper Transmitted Virescence Agent (BLTVA) Phytoplasma has been molecularly characterized to be distinguishably different from other phytoplasma strains (Seemüller, 1998). In efforts to further characterize the BLTVA phytoplasma, previously cloned BLTVA plasmid DNA (Shaw, 1991) was partially sequenced and sequence-specific DNA probes were derived. Probes were hybridized with crude nucleic acids extracted from symptomatic BLTVA infected and uninfected periwinkle plants. Sequence-specific PCR primers designed amplified expected sized band products from both recombinant plasmid and from crude BLTVA infected plant DNA as confirmed by enzyme restriction analysis. RT-PCR results using these same primers with two BLTVA samples from different sources also yielded consistent banding patterns. These RT-PCR products amplified with the sequence specific primers determined that mRNA was transcribed from the sequenced fragment.

Thus far, an 864bp region has been sequenced from one of the recombinant BLTVA plasmids. Results of repeated sequencing reactions with the recombinant plasmids are in agreement, however no open reading frames (ORF) have yet been found within the sequenced regions of these clones. The primers designed from these regions have proved successful in RT-PCR reactions. Reproducibility of the RT-PCR product with BLTVA samples from various sources positively affirmed the transcription of mRNA from the sequenced BLTVA plasmid fragment. Further work will be done to determine and compare the sizes of the mRNA transcripts detected. Sequencing of the remainder of the fragments is ongoing.

Avocado sunblotch viroid detection using a simple PCR method. A. Dodds, D. Mathews, and J. Heick. Department of Plant Pathology, University of California, Riverside, CA 92521. Publication no. P-2000-0018-PCA.

We have developed a rapid, sensitive detection method based on RT-PCR (reverse transcription polymerase chain reaction), using a simple sample preparation method that uses filter paper strips dipped in extract and then tranferred to PCR reaction mix. Using this method we have re-confirmed ASBVd freedom in the main UCR avocado variety block and have determine the ASBVd status of important trees for growers, nurserymen and researchers. We have determined that leaves of a moderate age are optimal for PCR testing. Leaves from a new flush of growth which have not yet hardened off or old leaves which are nearing senescence do not give consistent results. All parts of the leaf are satisfactory, we use a slice of tissue from the middle of the leaves which includes a section of the midrib. When testing individual branches of an infected tree, not all branches tested positive. Avocado fruit itself is also a satisfactory source of tissue and gives a strong PCR result. We have identified several samples in which the fruit was symptomatic for ASBVd and tested positive for it by PCR. However, the tree itself repeatedly tested negative for ASBVd. For almost a year, monthly collections from symptomless carriers of ASBVd have been made and analyzed by PCR. To date, no decline in the sensitivity of detection has occurred regardless of the time of year.

Influence of soil nitrogen and mycorrhizae on Pacific madrone decline. M. ELLIOTT, E. Cline, and R. L. Edmonds. College of Forest Resources, University of Washington, Seattle, WA 98195. Publication no. P-2000-0019-PCA.

Pacific madrone (Arbutus menziesii Pursh) has been declining in urban areas due to a canker disease caused by the fungus Nattrassia mangiferae. Environmental stress is important in making the trees susceptible to disease. Stress caused by high available soil nitrogen is examined in this study. Madrones growing alone and in mixed stands with conifers were compared with respect to tree health and soil conditions including pH, moisture, and net nitrification. Tree health was determined by percent foliage relative to diameter and amount of disease from canker, dieback, and root rot. Root tips of madrones were examined for mycorrhizae. Madrones growing in mixed stands had more mycorrhizal morphotypes. There was a trend towards lower available nitrogen in the soil in mixed stands. Unhealthy madrones growing with conifers had the lowest soil pH, and more Armillaria root disease. Soils near unhealthy madrones had higher net nitrification rates than did soils near healthy madrones. It is possible that increased nitrogen in the soil reduces mycorrhizal colonization of roots and negatively affects tree health.

Detection and quantification of metalaxyl using the MIDI Microbial Identification System. J. J. FARRAR and R. M. Davis. Department of Plant Pathology, University of California, Davis, CA 95616. Publication no. P-2000-0020-PCA.

Metalaxyl is widely used for control of cavity spot of carrot. We are investigating the degradation of metalaxyl in carrot field soils and needed an efficient quantification method. We examined the possibility of using the MIDI-GC Microbial Identification System version 6.0 to detect and quantify metalaxyl levels in soil and plant tissue. Samples included dilutions (0 to 150 ppm ai) of technical metalaxyl and Ridomil Gold EC (Ridomil) in methanol, soil spiked with Ridomil (0 to 300 ppm ai), and cotton seed treated with Ridomil (0, 0.002, and 0.02 ml ai/ 200 seeds) prior to germination. Soil and cotton radicle samples were dried in a 70°C oven, extracted in methanol, evaporated in a fume hood, and reconstituted in hexane. Samples were run using the aerobe subprogram of the MIDI. Technical metalaxyl dilutions gave a single peak at 10.8 minutes. The 10.8 minute peak was the largest peak in the Ridomil dilutions and was present in the soil and cotton radicle samples. The relationship between area under the 10.8 minute peak and concentration was linear from 5 to 150 ppm for technical metalaxyl and Ridomil and from 5 to 100 ppm for spiked soil samples.

Evaluation of detection methods for Colletotrichum acutatum in anthracnose-infected almond tissues. H. FÖRSTER and J. E. Adaskaveg. Dept. of Plant Pathology, Univ. of California, Riverside, CA 92521. Publication no. P-2000-0021-PCA.

Almond anthracnose, caused by C. acutatum, has become a major problem for California almond growers. Symptoms of the disease on blossoms are easily confused with brown rot blossom blight or jacket rot. Leaf and fruit symptoms can also be confused with other diseases. For the accurate diagnosis of anthracnose-infected tissues we evaluated a commercially available ELISA kit for the detection of Colletotrichum spp. and a PCR amplification method using specific primers. Results of these two molecular assays were compared with results obtained from isolations and fungal identification based on morphology, assuming that the isolation results were 100% accurate. Symptomatic almond tissues were collected throughout the growing season and the identification methods were performed on split-sample aliquots. Our results indicated that the ELISA and PCR methods were accurate for 83% or 74% of the samples, respectively. Additionally, the ELISA method is quick, cost-effective, and requires little technical expertise or equipment. Thus, this assay is a promising alternative for identification and monitoring of this almond disease.

Latent pine wilt infection as a disease source in consecutive years. K. FUTAI. Publication no. P-2000-0022-PCA.

Japanese red pine trees at the Kamigamo Experimental Station, Kyoto University Forests, 9 km north of Kyoto City, have been devastated by pine wilt disease since the end of the 1960s. I mapped 178 red pines which have survived in a 1.8 ha area, then overlaid the distribution maps of pines trees killed during the preceding10 years in the area. The maps show that 810 Japanese red pines were present in 1985, i.e. pine wilt disease has killed almost 80% of the pines. The epidemic nature of pine wilt spread was examined by analyzing the spatial distribution pattern of dead trees. Correlation between distribution of dead pine trees for all pairs of consecutive, 2 year periods was analyzed and significant overlapping was found between some consecutive 2-year periods. This suggests that latent infect of trees might play an important role in recurring wilt disease in areas where all dead pine trees (which serve as sources of infection) are removed.

Crop rotation for management of rhizomania disease of sugarbeets. J. J. GALLIAN and R. L. Roemer. University of Idaho, Twin Falls Research and Extension Center, P.O. Box 1827, Twin Falls, ID 83303-1827. Publication no. P-2000-0023-PCA.

Rhizomania is one of the most serious diseases of sugarbeets (sb) worldwide. Currently available resistance levels alone are not sufficient to prevent significant yield losses under severe disease conditions. Sugarbeet yields as influenced by cultivar susceptibility and crop rotation were measured in a 5-year study. Following a rotation with potato-bean-barley in a field with a history of severe rhizomania, a resistant cultivar of sb yielded 68.8 t/ha, while a susceptible cultivar yielded only 39.7 t/ha. However, if sb followed sb, the yields were much lower in both resistant (36.1 t/ha) and susceptible (15.7 t/ha) cultivars. Oilseed radish, commercially used as a trapcrop for control of sb cyst nematode, reduced rhizomania severity and increased sb yield by 8.1 t/ha with a resistant cultivar and 7.9 t/ha with a susceptible cultivar. Integrated disease management with resistant cultivars and proper crop rotation can significantly reduce rhizomania impact and result in economically acceptable yields.

Comparative sequence analysis of endochitinases of Trichoderma. P. A. GAY (1), M. Cheng (1), E. Koch (2), and J. H. McBeath (1). (1) Plant Pathology and Biotechnology, University of Alaska Fairbanks, Fairbanks, AK 99775; (2) Federal Biological Research Centre for Agriculture and Forestry (BBA), Institute for Biological Control, D-64287 Damstadt, Germany. Publication no. P-2000-0024-PCA.

The 42 kD endochitinase of Trichoderma harzianum has been implicated as a component in the inhibition of plant pathogens. The gene encoding for this endochitinase has been well characterized. Specific primers corresponding to the flanking region of the 42 kD endochitinase gene were used to amplify corresponding genes in native Alaskan, Chinese and European Trichoderma strains. A 1.4 kilobase major amplification product was observed in most of the Trichoderma strains. Sequence analysis and comparison of the major amplification product revealed greater than 90% similarity to the published sequence of the 42 kD endochitinase gene from T. harzianum and single nucleotide differences in the endochitinase genes between strains was observed. Further studies are ongoing to determine if the observed single nucleotide differences may have an effect on the amino acid sequence resulting in a potential conformational change in the corresponding protein.

Occurrence of brown root rot of alfalfa in the continental United States. F. A. GRAY (1), C. R. Hollingsworth (1), and D. W. Koch (1). (1) Department of Plant Sciences, University of Wyoming, Laramie, WY 82071-3354. Publication no. P-2000-0025-PCA.

Brown root rot (Phoma sclerotioides) was first described from North America on alfalfa from Canada in 1933. It was found for the first time in the continental U.S. in Wyoming in 1996, causing severe root rot and winterkill in two-year-old or older stands of alfalfa. It was reported from Wyoming in 1997. Pathogenicity of a Wyoming isolate of P. sclerotioides was shown on alfalfa plants, variety Multi-plier, following a four-month exposure period to winter conditions in Laramie, Wyoming. Disease incidence and severity increased during a second exposure period of seven months, the following year. In another experiment, in which severe disease and mortality occurred following the first exposure period of seven months, plants of the Canadian variety Peace, had significantly less disease and greater forage yield than did plants of Multi-plier. Current studies are focusing on isolate pathogenicity and host resistance.

Antifungal properties of root exudates from Asparagus densiflorus. C. Y. HE and D. Wolyn. Department of Plant Agriculture, University of Guelph, Guelph, Ontario, N1G 2W1. Publication no. P-2000-0026-PCA.

Root exudates from Asparagus densiflorus plants exhibiting hypersensitive cell death upon inoculations with F. oxysporum f. sp. asparagi (FOA) were examined for antifungal properties. Poor spore germination and germ tube growth of F. proliferatum and F. oxysporum f. sp. asparagi, lycopersici and cyclaminis were observed in the root diffusate of A. densiflorus, which was pre-challenged by FOA for 24-h. No inhibition of spore germination and growth was found for exudates from the unchallenged control plants and the fungal germination fluid. The results suggested that inhibitory compounds are inducible by fungal inoculations. Treatments of diffusate with proteinase K and boiling did not affect inhibition of spore germination and growth, suggesting inhibitory compound(s) in diffusate might be heat-stable secondary metabolite(s).

Solanaceous hosts as sources of inoculum for late blight on potato in the Pacific Northwest. D. Inglis, M. Derie, B. Gundersen, E. Vestey; and, R. Ludy and M. Powelson. WSU-REU, Mount Vernon, WA 98273; and, OSU Dept. Botany and Plant Pathology, Corvallis, OR 97331. Publication no. P-2000-0027-PCA.

Seventeen species in 11 genera (Capsicum, Datura, Lycium, Lycopersicon, Nicandra, Nicotiana, Petunia, Physalis, Salpiglossis, Schizanthus, Solanum) of the Solanaceae, most of them available from nurseries in the PNW, were evaluated for susceptibility to late blight during 1999. Each entry of 1-10 plants, replicated 3 times, was rated weekly for percent disease occurring naturally in the field. Excised leaves or leaf discs of each entry also were inoculated with US-11 and US-8 Phytophthora infestans, incubated at 18 degrees C, and lesions evaluated for sporulation. At Mount Vernon the susceptible hosts (field symptoms; 75-100 percent lesions sporulating with US-11 or US-8) were red and yellow currant (L. pimpinellifolium), bittersweet (S. dulcamara), glasnevin (S. crispum), and a potato control (S. tuberosum). Petunia (P. hybridia) was moderately resistant (limited/no field symptoms; 25-100 percent sporulating lesions) to both US-11 and US-8, while butterfly flower (S. pinnatus) and Apple of Peru (N. physalodes) were moderately resistant to US-11 and US-8, respectively. All other hosts were resistant. Red and yellow currant, bittersweet, Apple of Peru and potato also were susceptible to US-8 in laboratory tests at Corvallis. Plants grown as ornamentals in the PNW may serve as sources of inoculum for epidemics of late blight on potato.

Isolation of microsatellites from Peronospora parasitica, a biotrophic fungal pathogen of crucifers. M. Jugmohan, P. N. Achar, J. A. Lucas* and Keith J. Edwards*. Department of Microbiology, University of Durban-Westville, Private Bag X54001, Durban 4000. *Department of Cell Biology, IACR-Long Ashton Research Station, University of Bristol, England, UK. Publication no. P-2000-0028-PCA.

Downy mildew disease caused by the fungus Peronospora parasitica infects a wide range of cruciferous hosts including the cultivated Brassicas. Although certain isolates may be able to infect a heterologous host to different extents, most isolates are pathotype specific. Many pathotypes are known viz., Brassica oleracea, B. napus, B. juncea, B. rapa pathotypes as well as the Arabidopsis thaliana pathotype. The relationship of the various pathotypes at the molecular level is still unclear. The aim of the current study was to prepare a genomic DNA library enriched for microsatellites and use the primers thus derived to assess the molecular relatedness among isolates of P. parasitica. DNA was extracted from isolated P005 (P1 mating type of the B. oleracea pathotype) and used in the preparation of the library. Preparation of the library involved a series of steps. DNA was first digested with restriction enzymes, adapters were ligated, followed by pre-amplification using PCR. The DNA was then denatured and microsatellites were selected by hybridisation to prepared membranes containing bound oligonucleotides. These were then cloned into PJV1 and then transformed into E. coli DH5alpha competent cells. Positive colonies were selected by hybridisation with labeled microsatellite probes and plasmids were prepared using the Promega kit. Thereafter clones were sequenced using the ABI Prism automated sequencing system and primers were designed. Primers were then used to assess polymorphism among different isolates of P. parasitica. The results indicate a high level of microsatellite sequences in P. parasitica which is significant when comparing isolates of different pathotypes.

Effects of dazomet rate and incorporation implement on seedling production in forest nurseries. J. JUZWIK (1), K. W. Kromroy (1), and D. L. Stenlund (2). (1) USDA Forest Service, North Central Research Station, St. Paul, MN 55108; (2) MN Department of Transportation, St. Paul, MN 55155. Publication no. P-2000-0029-PCA.

Dazomet is an alternative to methyl bromide for preplant soil fumigation in USA forest nurseries. Uniformity and depth of incorporation are important factors in the application of the surface applied granular product. Trials were conducted at two nurseries using five tillage implements (three rotary tillers, a disc cultivator and a spading machine) and two dazomet (DAZ) rates (285 and 570 kg prod. ha-1) to determine their effects on seedling quantity and quality. Mortality and root disease severity ratings (DSR) of white pine seedlings were higher at the Wisconsin nursery than the Michigan nursery. Significantly lower mortality and DSR were found at the high DAZ rate than at the low DAZ rate for three of the four implements after three growing seasons in Wisconsin. In general, mortality and DSR were lowest and percentages of shippable seedlings were highest for the spading machine for both DAZ rates. These results support previous reports that showed the superiority of the spading machine when the chemical fumigant must reach depths below 18 cm.

Pathogenicity of Phaeoacremonium spp. on grapevine in California. A. Khan, C. Whiting, and W. D. Gubler, 2000. Department of Plant pathology, University of California, One Shields Ave., Davis, CA 95616. Publication no. P-2000-0030-PCA.

Autoclaved sand was infested with a spore suspension (4×107 conidia/gm sand) of Phaeoacremonium inflatipes, P. aleophilum and P. chlamydosporum and single bud dormant cuttings of grapevines of cv Chardonnay were placed in infested sand for three weeks at 27 C. Phaeoacremonium inflatipes was isolated from 66%, P. aleophilum from 59%, and P. chlamydosporum from 7% of the cuttings. In dormant cuttings P. chlamydosporum, P. aleophilum and P. inflatipes inhibited callus formation in 22%, 62%, and 72%, of the cuttings, respectively. Dormant cuttings artificially infected by P. inflatipes, P. aleophilum and P. chlamydosporum, were planted in a greenhouse and held for four months. Diseased plants had significantly (p=0.0001) reduced numbers of roots, shoot growth, number of internodes and dry weight of the above ground parts. However, no significant (p=0.1969) effect was found on overall root dry weight. Vascular discoloration occurred in spurs of Pinot Noir and Chardonnay inoculated with P. chlamydosporum, P. inflatipes and P. aleophilum inoculated (107 conidia/ml)through pruning wounds. Invasion of spurs of Pinot Noir and Chardonnay inoculated with P. chlamydosporum was significantly more extensive than invasion by P. inflatipes and P. aleophilum (p=0.0001).

PCR-RFLP marker differentiation of Ophiostoma piliferum from other Ophiostoma sapstaining species. S. H. KIM (1), S. Schroeder (2), and C. Breuil (3). (1) Chair of Forest Products Biotechnology, Dept. of Wood Science, University of British Columbia, 2424 Main Mall, Vancouver, BC, V6T 1Z4, Canada; (2) Dept. of Geomicrobiology, ICBM, Carl von Ossietzky University of Oldenburg, PO Box 2503, 26111 Oldenburg, Germany. Publication no. P-2000-0031-PCA.

To develop diagnostic markers for O. piliferum, a wood-stainer causing important losses in the wood industry, we examined its relationships to other Ophiostoma species using the nuclear ribosomal RNA gene sequences. Phylograms based on the sequences of the 18S, 5.8S, and 26S rRNA and internal transcribed spacers 1 and 2 (ITS1 and ITS2) suggested that O. piliferum could be separated from most of the other sapstain Ophiostoma species. Then, we verified the presence of polymorphisms in the 26S rRNA gene. For that we amplified a part of the 26S rRNA gene (900 bp) by PCR from 77 strains of nine common sapstaining Ophiostoma species and digested the PCR products with 29 restriction enzymes. Among the enzymes tested, only Hae III generated a unique RFLP pattern for O. piliferum. This RFLP pattern was identical among the fifty-two O. piliferum strains collected from different geographic regions. We also observed intraspecific variation in the beta-tubulin gene after digestion by Hinf I or Spe I. USA O. piliferum strains were separated from the strains of western Canada, New Zealand, and Europe, but not from the strains of central Canada. Using PCR-RFLP markers, we were able to rapidly detect O. piliferum on wood and the detection was feasible within 4 to 6 hours.

Cloning and characterization of a melanin biosynthetic THN reductase gene from Ophiostoma floccosum. S. H. KIM (1), R. M. Eagen (1), J. W. Kronstad (2), and C. Breuil (1). (1) Chair of Forest Products Biotechnology, Dept. of Wood Science, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada; (2) Biotechnology Laboratory, Dept. of Microbiology and Immunology, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada. Publication no. P-2000-0032-PCA.

Colonization of logs and lumber by O. floccosum causes a brown to black discoloration. To understand the role of melanin in this wood-staining fungus, we have cloned and characterized a reductase gene involved in melanin biosynthesis. Using degenerated primers and PCR, a reductase clone was isolated from an O. floccosum genomic library and 1681 bp of its nucleotide sequence was determined. It contained 605 bp of 5' untranslated sequence, a 883 bp open reading frame encoding 269 amino acids, and 193 bp 3' untranslated sequence. A 76 bp intron in the reductase-encoding gene was detected. The O. floccosum reductase shared 43-48% amino acid sequence identity with other fungal tri- or tetra-hydroxynaphthalene (THN) reductases. To study the function of the cloned O. floccosum reductase gene, we complemented THN reductase deficient buf mutants of the rice blast fungus Magnaporthe grisea. The complemented M. grisea buf mutant recovered a black color like the wild type, indicating functional homology. The results confirmed that O. floccosum uses the di-hydroxynaphthalene (DHN) pathway for melanin production.

A new fusarium wilt of canola in Alberta, Canada in 1999. R. M. LANGE (1), L. M. Harrison, and P. D. Kharbanda (1). Alberta Research Council, P.O. Bag 4000, Vegreville, Alberta T9C 1T4; 2) Alberta Agriculture, Food and Rural Development, Box 29, Beaverlodge, Alberta T0H 0C0. Publication no. P-2000-0033-PCA.

A wilt disease previously unreported in North America was observed in the Peace River and north-east regions of Alberta in July to September, 1999. The disease induced chlorosis, stem necrosis, vascular discoloration and premature desiccation in Brassica napus and B. rapa. Disease incidence in some fields reached 29%. Fully- and partially-wilted plants yielded 0.2 and 19.3% of asymptomatic plants, respectively. Fusarium avenaceum and F. oxysporum were isolated from surface-sterilised vascular tissue of affected plants. Severe wilt symptoms were produced when stems of B. napus plants were inoculated with F. avenaceum using root dip and stem inoculation methods. When root-dip inoculation was used, F. avenaceum killed 75 to 90% of the inoculated plants while F. oxysporum killed 40% of the plants. Brassica napus plants tested at the 1- to 7-leaf stages were equally susceptible to F. avenaceum. In stem inoculation tests, F. avenaceum caused severe wilting, while Fusarium oxysporum produced only small lesions around the inoculation points.

PCR-based markers for the identification of Phoma sclerotiodes infecting alfalfa. R. C. Larsen (1), G. J. Vandemark (1), F. A. Gray (2), and M. GRITSENKO (3). (1) USDA, ARS, Prosser, WA 99350; (2) University of Wyoming, Laramie, 82071; (3) Washington State University, Prosser, WA 99350. Publication no. P-2000-0034-PCA.

Brown root rot of forage legumes is caused by the soilborne fungal organism Phoma sclerotiodes and has caused severe mortality rates in alfalfa crops grown in southwest Wyoming. Total nucleic acid extractions were made from 19 different geographical isolates of the organism. Oligonucleotide 10-mer RAPD primers have been identified from PCR reactions that reveal polymorphisms specific to P. sclerotiodes. The primers did not produce equivalent amplification products in other soil-inhabiting pathogens including Aphanomyces euteiches, Fusarium oxysporum, Verticillium albo-atrum, Phytophthora infestans, and Rhizoctonia solani. A group of at least four of the isolates originating from Boulder, WY resulted in unique polymorphisms not produced in the remaining 15 isolates when primers OpB 1, OpB 4, OpB 12 and OpC 12 were tested. This preliminary evidence suggests that the 4 isolates are phylogenetically distinct. The design of a SCAR marker specific for the detection of P. sclerotiodes is in progress.

Effect of red clover vein mosaic carlavirus infection on seed production and biomass yield in chickpea. R. C. LARSEN and P. N. Miklas. USDA, ARS, Prosser, WA 99350. Publication no. P-2000-0035-PCA.

The effects of red clover vein mosaic virus (RCVMV) on biomass, seed yield and quailty reduction in chickpea (Cicer arietinum L.) were evaluated under field and greenhouse conditions. Test plants were inoculated with the virus at pre-bloom (PE), bloom (B), and post-bloom (PO) stages. Biomass was significantly (P=0.05) reduced in PE and B plants but not in PO plants. Mean dry weights were 136.7 and 31.4 g for B and PE treatments, respectively, compared to 289.2g in the healthy treatment. Seed collected from infected plants resulted in yield losses of 61.5% and 49.9% for B and PO, respectively. Plants inoculated at the PE stage resulted in losses of 100%. Seed quality as evaluated by seed size, was markedly reduced in all infected treatments. Quality decreased proportionally with earliness of infection. Only 2.3% of premium size 26 seed was obtained in the PO treatment compared to 9.8% in healthy. Seed size 24 consisted of 18.9, 52.7, and 78.7% of the total yield from B, PO, and healthy, respectively. The greatly reduced yields suggest that control of the aphid vector (Acyrthosiphon pisum (Harris)) of RCVMV is critical at pre-bloom stages of crop growth in virus-affected areas.

The green fluorescent protein (GFP) to monitor Cartapip and staining fungi in wood. S. W. LEE, S. H. Kim, and C. Breuil. Chair of Forest Products Biotechnology, Dept. of Wood Science, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada. Publication no. P-2000-0036-PCA.

We tested the feasibility of using the GFP as a biomonitoring tool for a wood protecting biocontrol agent, Cartapip (Ophiostoma piliferum) and for a sapstaining fungus O. piceae.The two fungal species were transformed with gGFP plasmid. The GFP gene was integrated into the chromosomes of the two fungi and stably maintained. The GFP gene insertion had no effect on fungal growth and pigmentation. We observed under the fluorescence microscope the GFP expression in different types of cells, including yeast-like spores, synnemata, and mycelium. The GFP transformants were easily distinguished from the wild-type strains and the other fungal species both on culture media and on wood. Green fluorescence in fungal cells could be detected up to 4 months after infection on wood. Our results demonstrated that the GFP marker is easily detectable and can be used to map the spatial distribution of fungi in the environment.

Detection of gene expression in an open reading frame of SAY infected periwinkle plants using RT-PCR and Northern Blot analysis. L. Maes, H. Flores, and M. Shaw. New Mexico Highlands University, Las Vegas NM 87701. Publication no. P-2000-0037-PCA.

The Severe strain of Western Aster Yellows (SAY) phytoplama has been well categorized with resepect to taxonomic and nomenclature analysis. However little of its mechanistic approaches to replication and gene expression have been explored. A segment of Severe strain of Western Aster Yellows (SAY) phytoplasma DNA, approximately 3 kb pairs long, was partially sequenced. The sequence was then used to locate new open reading frames (ORF) and furthermore detect gene expression at time-specific intervals during plant development. Whole SAY infected plant RNA was used for RT-PCR analysis along with primers specific to the new ORF. This analysis confirmed gene expression in various 1 month old systematic SAY infected periwinkle plants and was furthermore complimented by Northern Blot analysis using gene specific probes against total SAY infected RNA for the specific plant and time interval.

Assessment of Swiss needle cast disease development. II. Temporal and spatial investigations of fungal colonization and symptom development. D. K. Manter (1), L. A. Winton (2), G. M. Filip (1), and J. K. Stone (2). (1) Forest Science Department, (2) Department of Botany and Plant Pathology, Oregon State University, Corvallis OR 97331. Publication no. P-2000-0038-PCA.

Swiss needle cast (SNC) is a foliar disease of Douglas-fir caused by the fungus Phaeocryptopus gaeumannii. SNC occurs throughout the range of Douglas-fir and its increasing severity has become the cause of concern throughout coastal Oregon and Washington. Symptoms of disease in P. gaeumannii infected trees were well correlated with fungal colonization. Furthermore, fungicide applications that reduced P. gaeumannii infection resulted in decreased needle abscission and chlorosis. Variation in fungal colonization was also detected within sites and tree canopies. Trees on south slopes from our coastal sites had higher fungal colonization and more severe symptoms compared to north slopes. However, for interior sites, north slopes had higher fungal colonization and symptoms. Within individual trees, fungal colonization was consistently higher both in the upper portions of the canopy and the south facing foliage. Spatial patterns of P. gaeumannii development vary both at the macro and micro-scales and are consistent with observed patterns of symptom development. The strong correlation between fungal colonization and symptom development supports our model in which the major impact of SNC on host physiology is through stomatal occlusion and reduced gas exchange.

Comparative effect of Actigard and Ridomil Gold on development of Phytophthora crown and root rot on chile pepper plants. M. E. MATHERON and M. Porchas. Yuma Agricultural Center, University of Arizona, Yuma, AZ 85364. Publication no. P-2000-0039-PCA.

The activity of foliar applications of Actigard (acibenzolar-S-methyl) was compared to a soil drench application of Ridomil Gold (mefenozem) with respect to plant survival and growth of chile pepper plants in field soil naturally infested with Phytophthora capsici. Two-month-old Anaheim TMR 23 chile pepper plants received either three treatments of Actigard at a rate of 75 mg a.i./liter of water or one treatment with Ridomil Gold at a rate of 100 mg a.i./liter. Plants were either watered as needed (every 2-3 days) or subjected to a 48 hr flooding period every 2 weeks for a period of 2 months. For nonflooded and flooded soil, survival and shoot growth were significantly higher for plants receiving Actigard compared to nontreated pepper plants; however, corresponding values for plants receiving Ridomil Gold were significantly higher than those treated with Actigard. In flooded soil, root growth for plants treated with Ridomil Gold was significantly greater than that for plants treated with Actigard; however, when plants were watered as needed, no significant difference among chemical treatments was recorded.

Genetic diversity in the phloroglucinol biosynthetic locus of Pseudomonas fluorescens from different geographic locations. O. V. MAVRODI (1), D. V. Mavrodi (1), B. McSpadden Gardener (2), D. M. Weller (2), L. S. Thomashow (2). (1) Dept. of Plant Pathology, Washington State Univ., Pullman; (2) USDA-ARS, Pullman, WA 99164-6430. Publication no. P-2000-0040-PCA.

The reduction in take-all disease, caused by Gaemannomyces graminis var. tritici, that occurs during extended monoculture of wheat is called take-all decline (TAD). 2,4-Diacetylphloroglucinol (DAPG)-producing fluorescent Pseudomonas spp. that play a major role in TAD were isolated from soils of different geographical locations and cropping histories. Diversity within phlD, a key gene in the biosynthesis of DAPG, was studied by RFLP analyses. RFLP profiles within phlD largely correlated with clusters obtained by RAPD analysis, and were conserved among strains from the same site and cropping history. A set of strains representative of 30 phlD RFLP groups did not differ in the amounts of PHL produced in vitro. These strains were characterized for the presence of pyrrolnitrin and pyoluteorin biosynthetic genes by PCR and DNA hybridization. We conclude that phlD is useful as marker to study the genetic diversity and population structure of DAPG-producing Pseudomonas spp. in soil.

Determination of chitinase activity associated with mycoparasitism in Trichoderma atroviride from Alaska. J. H. MCBEATH and P. A. Gay. Plant Pathology and Biotechnology Lab, University of Alaska Fairbanks, Fairbanks, AK 99775. Publication no. P-2000-0041-PCA.

Trichoderma atroviride, a versatile, aggressive biological control organism found in Alaska, has strong activity against a broad spectrum of plant pathogens, e.g. Botrytis cinerea, Coprinus psychromobidus, Fusarium solani, Microdochia nivale, Myriosclerotinia borealis, Phytophthora infestans, Pythium spp., Sclerotinia sclerotiorum, Typhula spp., Verticillium dahlia, etc. Unlike many commercial biocontrol products that require elevated temperature to be active, Alaskan T. atroviride, with a temperature range of <4°C to 33°C, maintain strong activities at low temperatures. Several mechanisms are involved in the mycoparasitism and endochitinases are found to be a major component. Chitinase activities were determined spectrophotometrically and in plate assays through the quantitative degradation of glycol chitin both in the presence and absence of plant pathogens. Further investigations are being conducted to determine which chitinase isozymes are expressed differentially in T. atroviride in the presence of plant pathogens.

Bacterial populations associated with take-all disease on wheat. B. B. MCSPADDEN GARDENER and D. M. Weller. USDA-ARS Root Disease and Biological Control Research Unit, Washington State University, Pullman, WA 99164-6430. Publication no. P-2000-0042-PCA.

The composition of rhizosphere bacterial communities changed following infection of wheat roots by Gaeumannomyces graminis var. tritici. The abundance of Pseudomonas spp. was greater on diseased roots, based on culturing with selective media and T-RFLP analyses of root washes. Genomic fingerprinting of the most abundant culturable populations indicated an increase in the dominance of certain genotypes. Some of these bacteria were observed to be inhibitory to the take-all fungus in vitro. Other in vitro assays indicated that some of the dominant culturable populations also can interact with DAPG-producing biocontrol bacteria. The occurrence of these various bacterial populations in two different WA soils will be discussed.

Infection of Fiju apple by core rot fungi and disease control in California. T. J. Michailides, D. P. Morgan, and D. Felts. Publication no. P-2000-0043-PCA.

Core rot of apple has been recorded in Australia, Canada, Netherlands, New Zealand, South Africa, United Kingdom, and the United States. During late summer to early fall of 1993 through 1999 core rot was widespread throughout the apple-growing areas in California. The following fungal pathogens were isolated from core rotted apple samples: Coniothyrium sporulosum (77 to 100%), species of Alternaria (2.4 to 7.9%), Fusarium (1.6 to 2.4%), and Curvularia and non-filamentous yeasts (< 1%). Koch's postulates using C. sporulosum reproduced core rot symptoms in inoculated apples. Serial inoculations, starting at bloom and ending at harvest showed that fruit is most susceptible to infection by C. sporulosum during bloom time but infections continue to occur throughout the season. Propagules of C. sporulosum, up to 34,000 per flower spur, were recorded during full bloom in two commercial Fuji orchards. In only one year, Ziram 76 DF reduced core rot, while in two subsequent fungicide trials, none of the fungicides registered for apples in California reduced core rot.

Novel fungicidal metabolite from known plant pathogen useful for control of plant disease. T. C. MILLER (1), L. P. Sharp (1), R. W. Emerson (1), D. A. Peterson (1), R. H. Hughes (1), D. G. Crosby (2), and W. D. Gubler (2). (1) SummusGroup, LTD, Woodland, CA. (2) University of California, Davis, CA. Publication no. P-2000-0044-PCA.

The fungicidal efficacy of a secondary metabolite of a known plant pathogen is described. In natural form, either as an extract or synthesized, the characterized molecule shows broad fungicidal activity across several classes of fungi, particularly toward numerous plant and human pathogens among the higher fungi (deutero-, asco-, and basidiomycetes). Similarly, numerous natural co-metabolites and synthetic chemical analogs also show varying ranges of activity. Dose-response data for numerous target pathogens will be discussed vis a vis the combinatorial chemistry surrounding the toxiphore, a structure without known similarity in pesticidal chemistry. This suggests similar active molecules might be found in similar (niche/taxonomic) plant pathogens. Toxicological data will be discussed, along with greenhouse and field efficacy. Preliminary data suggests a novel, safe, effective, natural class of fungicidal chemistry.

Bacterial leaf streak of intermediate wheatgrass. S. K. MOHAN and V. P. Bijman. Research and Extension Center, University of Idaho, Parma, ID 83660. Publication no. P-2000-0045-PCA.

During July 1996, a field of intermediate wheatgrass (Elytrigia intermedia 'Rush') grown for seed in Washington County, Idaho was found affected by a disease with symptoms of leaf streaks and blighting. Lesions on the leaves appeared as water-soaked, translucent, long, narrow streaks that turned brown, necrotic, and often coalesced into blighted areas. Frequently, a honey-colored, dried, granular or flaky exudate was present on the lesion surfaces. A bacterium forming light yellow colonies on nutrient agar was consistently isolated from symptomatic tissues. Based on cultural characteristics, results from bacteriological tests, Biolog GN MicroPlates, fatty acid profiles, and pathogenicity to intermediate wheatgrass, wheat, barley, rye, oats and several grass species belonging to the genera Agropyron, Bromus, Dactylis, Elytrigia and Leymus, the bacterium was identified as Xanthomonas translucens pv. cerealis. An assay of the seedlot used for field planting showed a contamination level of 7.48 × 10(^4) cfu/g of seed, and greenhouse grow-out tests produced infected seedlings. This is the first report of natural occurrence of this pathogen on this grass species.

Selection of root endophytic fungi to suppress Verticillium wilt in eggplant. K. NARISAWA (1,2), H. Kawamata (1), and T. Hashiba (3). (1) Plant Biotechnology Institute, Iwama, Nishi-Ibaraki, Japan. (2) Department of Biological Sciences, University of Alberta, Edmonton, AB, T6G 2E9. (3) Department of Environmental Biotechnology, Tohoku University, Sendai. Japan. Publication no. P-2000-0046-PCA.

Verticillium wilt of eggplant, caused by the soilborne fungus, Verticillium dahliae, is one of the most serious plant diseases in the world. Biocontrol agents for the disease have not been developed or, if developed, have not been accepted widely by growers. A more effective control agent for the disease might be found among species that grow endophytically within the root tissues. We isolated fungi from eggplant, melon, tomato, strawberry, and Chinese cabbage roots and tested the isolates for their ability to suppress Verticillium wilt of eggplant. Ninety-nine isolates were recovered and eleven of these isolates almost completely suppressed the disease. Most of these were originally isolated from eggplant and included Fusarium, Heteroconium, Phialocephara, and Trichoderma species. Hyphae of three effective isolates (H. chaetospira, P. fortinii and Hyaline-septate fungus) extensively colonized the inner part of cortical tissues of the root axis without causing external symptoms.

First report of vesicular-arbuscular mycorrhizal fungi on Brassica and its effect on the downy mildew disease. R. Nelson and P. N. Achar. Department of Microbiology, University of Durban-Westville, Private Bag x 54001, Durban- 4000, South Africa. rnelson@pixie.udw.ac.za & pachar@pixie.udw.ac.za. Publication no. P-2000-0047-PCA.

The mutual association between three different species of vesicular-arbuscular mycorrhizal (VAM) fungi viz., Glomus aggregatum, G. fasciculatum and G. mosseae were first screened for symbiotic response with Brassica oleracea var. capitata (cabbage) cv. Hercules. The interaction of VAM and the downy mildew pathogen (Peronospora parasitica) and their effect on cabbage seedlings was also investigated under controlled environmental conditions. The establishment of VAM was confirmed using light and scanning electron microscopy. This is the first report on the VAM infection in cabbage. Seedlings inoculated with VAM fungi had a lower disease incidence than the non-mycorrhizal ones. Mycorrhizal seedlings inoculated with P. parasitica showed higher root and shoot dry weights than the non-mycorrhizal infected plants. However, the values were lower than the uninfected mycorrhizal seedlings. Significant difference in the contents of free amino acids (especially Arginine, Lysine, Phenylalanine, Proline and Serine) were found in mycorrhizal plants that were infected with P. parasitica. There were also significant changes in the soluble protein, phenol and other compounds between the various treatments. The mechanism by which VAM fungi can reduce downy mildew disease incidence in cabbage and contribute to the resistance of the host is discussed.

Influence of sub- vs. top-irrigation and surfactants in a recirculating cultural system on disease incidence caused by Phytophthora and Pythium in potted plants. C. J. NIELSEN (1), M. E. Stanghellini (1), D. H. Kim (1), S. L. Rasmussen (2), and P. A. Rorbaugh (2). (1) Department of Plant Pathology, University of California, Riverside, 92521; (2) Department of Plant Pathology, University of Arizona, Tucson, 85721. Publication no. P-2000-0048-PCA.

Zoospores of Phytophthora capsici and Pythium aphanidermatum were shown to spread, respectively, from inoculated source plants to healthy potted pepper and poinsettia plants located on separate ebb-and-flow benches solely via the recycled nutrient solution, which originated from a common reservoir. Amending the recirculating nutrient solution with a surfactant, which selectively kills zoospores, resulted in 100% control of the spread of these root pathogens from inoculated source plants in both ebb-and-flow and top-irrigated cultivation systems. In the absence of a surfactant in the recirculating nutrient solution, all plants in an ebb-and-flow sub-irrigation system died within 6 to 7 weeks. In contrast, all plants in a top-irrigated system died within 2 weeks. These latter results indicate that the use of recycled irrigation water in an ebb-and-flow cultural system is less conducive to pathogen spread than in a top-irrigated (i.e., drip) cultural system.

Potato late blight in Idaho from 1995-1999. P. NOLTE (1), R. Forster (2), S. Mohan (3), and N. Olsen (4). PSES Department, University of Idaho (1) 1776 Science Center Dr, Idaho Falls, ID 83402; (2) 3793 N 3600 E, Kimberly, ID 83341; (3) 29603 U of I Lane, Parma, ID 83660; (4) Box 1827, Twin Falls, ID 83030. Publication no. P-2000-0049-PCA.

New isolates of the late blight fungus (Phytophthora infestans) were found in southwest Idaho in 1995 in Canyon and Owyhee counties. Minor infestations also occurred in south central Idaho in Cassia, Minidoka and Jerome counties. Hot, dry conditions throughout the state in 1996 kept infestations to a minimum with only minor crop damage in the south central region reported. Wet conditions in 1997 were conducive for widespread late blight in the south central region and movement into the previously uninfested south eastern counties of Bingham, Bonneville, Power, Madison and Jefferson. Both 1998 and 1999 were hot and dry but minor infestations in the south central and south eastern production regions followed by significant rainfall in late August of 1998 led to widespread tuber blight during the storage season. Isolates in 1995 and 1996 were all US-8 while in 1997 US-6, US-7, US-8 and US-11 were detected. In 1998 US-8 and US-11 were found and in 1999 only US-8 was detected. Both mating types have been present but no new isolates have been reported.

Assessment of sweet cherry powdery mildew [Podosphaera clandestina (Wallr.:Fr.) Lev.] severity using digital image analysis. J. W. OLMSTEAD (1), G. G. Grove (2), and G. A. Lang (1). (1) Irrigated Agriculture Research and Extension Center, Washington State University, Prosser, WA 99350; (2) Tree Fruit Research and Extension Center, Washington State University, Wenatchee, WA 98801. Publication no. P-2000-0050-PCA.

A personal computer-based method for quantifying powdery mildew (PM) [Podosphaera clandestina (Wallr.:Fr.) Lev.] colonization of sweet cherry leaf disks was evaluated for increased accuracy and precision compared to visual assessment. Leaf disks from 14 cultivars were rated for PM severity (percentage of colonized leaf area) by: 1) visual assessment; 2) image analysis; and 3) image analysis after painting PM colonies. The latter technique, where PM colonies were identified using a dissecting microscope and subsequently covered with white paint, provided a standard for comparison of the other assessment methods. A low correlation (r(^2) = 0.66 and 0.46, P < 0.01) was detected between image analysis and painted PM area in two experiments, whereas visual assessment was highly correlated with painted PM area (r(^2) = 0.88 and 0.95 P < 0.01). Rank orders of the 14 cultivars differed significantly (P < 0.05) when image analysis was compared to painted PM area; however, visual assessment was not significantly different (P > 0.05) than painted PM area. Image analysis of PM area on sweet cherry leaf disks offered no significant improvement over visual assessment methods currently used, presumably due to the inability of the software to detect slight differences in color between PM and leaf tissue.

Effect of powdery mildew on pecan nut quality. M. W. OLSEN, S. Rasmussen, and C. Nischwitz. Department of Plant Pathology, The University of Arizona, Tucson, AZ 85721. Publication no. P-2000-0051-PCA.

In 1998 and 1999, heavy outbreaks of the conidial stage of pecan powdery mildew (Microsphaera sp.) occurred in a large orchard in southern Arizona. Disease appeared in early summer on the green shucks causing superficial lesions with dense sporulation. No other parts of the plant were affected. The fungus continued to sporulate sporadically until shucks began to dry in the fall. In order to determine if the infections were affecting pecan nut quality, ten pairs of symptomless clusters on each of ten trees in two different varieties were selected, and one of each pair treated with fungicide and the other left untreated. Biweekly applications of azoxystrobin, rotated with one treatment of myclobutanil, from June 28 through September 10, 1999, controlled mildew completely. At harvest, nut weight, development and color were determined using USDA Standards. Within variety, there were no differences (t-Test: paired two samples for means) in weight (all nuts) or color ranking (all developed nuts) between non-treated infected clusters and treated symptomless clusters in pairs. Results indicate that although shucks may have a high percentage of area infected by mildew, the infections do not affect nut quality, and fungicide treatments are not warranted.

Worldwide population structure of Alternaria sp. causing brown spot of tangerines and tangerine hybrids. T. L. PEEVER (1), A. Ibanez (2) and L. W. Timmer (2). (1) Department of Plant Pathology, Washington State University, Pullman, WA, USA; (2) University of Florida, CREC, Lake Alfred, FL, USA. Publication no. P-2000-0052-PCA.

Sixty-seven isolates of Alternaria sp. causing citrus brown spot were sampled from tangerine (Citrus reticulata) and tangerine × grapefruit (C. reticulata × C. paradisi) hybrids in six countries. Isolates were scored for variation at 16 putative RAPD loci and the population structure of the pathogen determined. Quantitative estimates of pathogenicity (disease incidence) were obtained for all isolates by spray-inoculating detached leaves. Analysis of RAPD allele frequencies revealed highly significant differentiation between samples of isolates from USA (Florida) and Colombia and samples from Turkey, South Africa, Israel and Australia. Private alleles (sensu Slatkin) were observed at 11 of 16 loci among all 6 countries. Analysis of RAPD phenotypes of individual isolates revealed at least 6 genetically distinct groups of isolates which did not necessarily correspond to country of origin. Large differences in pathogenicity were detected among isolates and those from the USA were significantly more pathogenic than isolates from other countries. These results indicate that the brown spot pathogen consists of several genetically and pathogenically distinct, non-recombining asexual lineages worldwide. The significance of this variation to brown spot breeding programs and pathogen evolution will be discussed.

Development of Phytophthora infestans in potato tubers of nine clones in storage. L. D. PORTER, D. A. Johnson, and T. F. Cummings. Department of Plant Pathology, Washington State University. Publication no. P-2000-0053-PCA.

Potato tubers of Russet Burbank, Russet Legend, Russet Norkotah, Bannock Russet, Gem Russet, Ranger Russet, Umatilla Russet, A84118-3, and A90586-11 were inoculated with an US-8 isolate of Phytophthora infestans by placing 0.05 ml of inoculum with 1 to 500 sporangia on a single tuber eye. Incidence and severity of rot was determined after 5-26 weeks in storage at 4, 7, and 9 C. Time until initial sporulation on infected tubers incubated at 10, 18, and 25 C was determined. Severity of internal rot was significantly less (P<0.05) for Umatilla Russet, Russet Legend, and A90586-11 than for the other clones. Ranger Russet and Bannock Russet were the most susceptible clones. Incidence of infection for Umatilla Russet did not differ from susceptible clones, but severity of rot was significantly less. Rot severity depended on temperature, inoculum concentration and time in storage. Rot at 4 and 7°C was significantly less than at 9°C. Infection in all infected tubers was evident within 5 weeks of storage at 9°C. Initial sporulation for all clones after removal from storage occurred within 17-19 hours at 25 and 18°C.

Sclerotinia stem infection in flax in Manitoba and Saskatchewan. K. Y. Rashid. Cereal Research Centre, Agriculture and Agri-Food Canada, Morden, MB R6M 1Y5, Canada. Publication no. P-2000-0054-PCA.

Flax (Linum usitatissimum L) is a major field crop in western Canada, grown on 1-1.5 million hectares annually. Sclerotinia sclerotiorum (Lib.) De Bary is a common plant pathogen affecting many crops in western Canada including canola, field peas, beans, lentils, and sunflower. This pathogen has not been reported affecting flax from the eastern Canadian Prairies prior to 1999. Early symptoms are small water-soaked lesions on the stem with light grey color. The lesions develop to cover most of the stem which become bleached-white in color. Advanced infections cause shredding, disintegration of the fibre, and stem breakage. Sclerotia formed inside the infected part of stems are cylindrical in shape with 1-2 mm in diameter and 5-30 mm in length. Disease survey of the flax growing areas in 1999 revealed the presence of S. sclerotiorum infections in 20% of the fields surveyed in Manitoba and 10% of fields surveyed in Saskatchewan. Disease incidence ranged from 1 to 30% infected plants, and severity ranged from 5-60% stem area affected. The disease was observed only in heavily lodged flax with no sign of infection in normal standing flax next to the lodged plants in the same field or adjacent fields. These observations suggest that lodging exposes the flax to sclerotinia infection by direct stem contact with infested soil. The recommendations for minimizing the disease damage are to use flax cultivars with good lodging resistance, avoid fields with high sclerotinia inoculum from previously infected crops, and avoid excessive soil moisture conditions.

Characterization of a Rhizoctonia-like fungus causing web-blight of Douglas-fir and true fir Christmas trees. P. W. Reeser, M. L. PUTNAM, L. M. Winton, and M. Nesson. Dept. of Botany and Plant Pathology, Oregon State Univ., Corvallis, OR 97331. Publication no. P-2000-0055-PCA.

A foliar web-blight of Douglas-fir and true fir caused by a bi-nucleate Rhizoctonia-like fungus has been observed in some Christmas tree plantations in Oregon since 1996. The disease can kill large areas of peripheral foliage rendering trees unmarketable. Symptoms may develop after trees have been graded and sold, but before harvest and shipment. Two isolates of the fungus were studied to determine taxonomic status. The isolates did not anastomose when paired with tester strains for AG-A, AG-B, AG-Ba, AG-E, AG-F, AG-G, AG-K or AG-R. Sequence analysis of ITS regions 1 and 2 of nuclear ribosomal DNA placed the isolates between Ceratobasidium cornigerum and Ceratobasidium oryzae-sativae. Transmission electron microscopy of the septal pore apparatus revealed a dolipore septum and parenthesomes with few, large perforations. While anastomosis group analysis was inconclusive, the bi-nucleate condition, septal pore ultrastructure and DNA sequence analysis suggest that the Douglas-fir and true fir web-blight fungus belongs in the genus Ceratobasidium.

Characterisation of a cloned fragment of the severe strain of aster yellows (SAY) Phytoplasma plasmid DNA. J. RIR-SIMA-AH (1), D. Crombie (1), and M. E. Shaw (1). (1) Department of life Sciences, New Mexico Highlands University, Las Vegas, NM 87701. Publication no. P-2000-0056-PCA.

Extrachromosomal DNA molecules(plasmids)encoded traits are important in determining pathogenicity and virulence in several plant pathogenic bacteria. Plasmids have also been found associated with many Phytoplasmas, but their role remains unclear. Plant pathogenic Phytoplasma plasmid DNA may posses genes with the potential to affect Phytoplasma pathogenicity. A cloned fragment of plasmid DNA from the severe strain of aster yellows(SAY) has been partially sequenced. Using primers designed from the partial sequence, Polymerase chain reaction gave PCR products of the expected size from isolates of SAY infected periwinkle plants, but not healthy plants. BLAST search was done for sequence comparisons. To determine whether Putative Open Reading Frames(ORFs) are transcribed in infected plants, primers were designed for RT-PCR with total RNA from infected and healthy plants. While the plasmid is being completely sequence, no function has yet been ascribed to the partially sequenced fragment.

Virus-infected native lupine detected in Hatcher Pass, Alaska. N. L. ROBERTSON and D. F. Knight-Slater. USDA/ARS, Arctic Plant Germplasm Repository, Palmer, AK. Publication no. P-2000-0057-PCA.

Studies on plant viruses infecting native plants in Alaska are scarce. We detected diseased Lupinus nootkatensis plants in their natural habitat in the Hatcher Pass region north of Anchorage, Alaska. Leaf symptoms consisted of prominent vein-clearing and some stunting. Partially purified particles were isolated from diseased leaves and not from healthy plants. Virions appeared to be about 25 nm isometric particles when stained with uranyl acetate and viewed with the electron microscope. Ultrathin sections of diseased leaves contained similar virus particles and inclusion bodies in the cytoplasm. Protein extracts from purified virions produced a 41-42kDa protein presumed to be the coat protein. Virion RNA was determined to be about 4.3Kb without a poly(A)-tail; a corresponding synthesized cDNA fragment was sequenced. Based on the given parameters of the shape and size of the virions, the size of the coat protein and RNA genome, and a partial nucleotide sequence, we conclude that the virus belongs to the plant virus family Tombusviridae.

The use of hot water treatments to effectively control Phaeoacremonium vine decline of grapevines. S. N. Rooney (1) and W. D. Gubler (1). (1) Department of Plant Pathology, University of California, Davis 95616. Publication no. P-2000-0058-PCA.

Decline of young grapevines caused by Phaeoacremonium spp. has become a serious disease in some California vineyards. Effective control of this disease has been elusive. One control program often used to eradicate pests in grapevines is the use of hot water treatments. The immersion of inoculated cuttings for thirty minutes in a 51°C water bath, was tested for effectiveness in eliminating Phaeoacremonium spp. Dormant grapevine cuttings were inoculated with a spore suspension of P. chlamydosporum or P. inflatipes by vacuum infiltration. Following inoculation and treatment in hot water, cuttings were incubated two to four weeks then evaluated for vine decline symptoms. Results obtained from symptom evaluations and isolations of the cuttings indicate that a hot water treatment of 51°C for thirty minutes is ineffective in eliminating Phaeoacremonium spp. Cuttings inoculated and treated with hot water showed similar vascular streaking to those inoculated non-treated cuttings. In addition, Phaeoacremonium spp. were differentially recovered from the hot water treated cuttings depending on grapevine variety.

Occurrence and distribution of Bipolaris sorokiniana in eastern Washington. K. L. SCHROEDER and D. M. Weller. USDA-ARS, Washington State University, Pullman, WA 99164. Publication no. P-2000-0059-PCA.

Common root rot of wheat was previously reported to be of little importance in Washington State. A survey of eastern Washington winter wheat fields was conducted in the fall of 1999 to document the occurrence of fungal root pathogens. During the survey, 10 to 15 wheat plants were removed from each of 81 different fields throughout eastern Washington. The wheat roots were washed and placed into a cone-tainer with vermiculite. The pathogens were baited by planting barley into the cone-tainers and allowing the roots to grow into the washed wheat roots. Of the samples collected, 85% were found to have symptoms indicative of Rhizoctonia root rot or common root rot. Upon isolation from the diseased root segments, Bipolaris sorokiniana was recovered from 62% (43 locations) of the infected plants. One isolate was recovered from symptomless plant tissue.

Comparison of copper octanoate and copper hydroxide for controlling cucumber powdery mildew. F. S. Sedun and C. D. Wilson. Publication no. P-2000-0060-PCA.

Cucumber powdery mildew Sphaerotheca fuliginea is a common disease of cucurbits. Copper octanoate (CuC8) is a new fungicide that is effective against this and other diseases. CuC8 is a salt of the naturally occurring fatty acid, octanoic acid. Cucumber plants (variety Revenue) were grown in a soil-less mix under greenhouse conditions. One and eight days after emergence, plants were sprayed with copper octanoate at concentrations of 90 and 180 ppm Cu(^2). Copper hydroxide (CuOH) treatments (90, 180 and 1000 ppm (Cu(^2)) were included as standards. Twelve days after the first spray the cotyledons of the CuC8 treatments (90 and 180 ppm) had mildew coverage of 24 and 0%, respectively. The CuOH treatments (90, 180 and 1000 ppm) had mildew coverage of 80, 67 and 56%, respectively. Untreated plants had a mildew coverage of 99.6%. These results have been confirmed by extensive greenhouse and field tests. We do not know why CuC8 is more effective than CuOH against powdery mildews.

Use of antagonistic bacteria to control blister spot of apple in British Columbia. P. L. SHOLBERG (1) and K. E. Bedford (2). Agriculture & Agri-food Canada, Pacific Agri-Food Research Centre, Summerland, BC V0H 1Z0. Publication no. P-2000-0061-PCA.

Blister spot, a bacterial disease of apples caused by Pseudomonas syringae pv. papulans is a serious problem on Mutsu. Trials in 1997 in British Columbia on four popular cultivars showed that Jonagold and Fuji were also susceptible to blister spot. The potential of two bacterial antagonists, Pseudomonas sp. isolate 1100-6, and Bacillus sp. isolate EN-63, for the control of blister spot was established in a preliminary 1997 trial. Disease incidence and severity were reduced on Mutsu, Fuji, and Jonagold cultivars. In 1999 a more substantial field trial was established. One spray application of 1100-6, was highly effective in reducing disease incidence and severity of blister spot on Mutsu apples when applied once during the infection period (two to four weeks after bloom), and challenged with the blister spot pathogen two days, and three weeks later. The commercial product, BlightBan, a dry formulation of Pseudomonas fluorescens isolate A506, EN-63, as well as 1100-6 were also tested on Jonagold apple with inconclusive results.

Genetics of resistance to the chlorosis component of tan spot of wheat. P. K. SINGH and G. R. Hughes. Department of Plant Sciences, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK S7N 5A8. Publication no. P-2000-0062-PCA.

Tan spot, caused by the fungus Pyrenophora tritici-repentis, is an important foliar disease of wheat throughout the world and particularly in western Canada. Two phenotypically distinct symptoms are associated with this disease, tan necrosis and extensive chlorosis. This study investigated the genetic control of the chlorotic component in five resistant wheat cultivars. Resistant cultivars Red Chief, Hadden, Erik, Glenlea and 86ISWN 2137 were crossed with the susceptible cultivar 6B-365. A partial diallel series of crosses among the resistant cultivars was also made to determine allelism of the resistance genes. For both sets of crosses, F(1) and F(2) plants and F(2:3) families were tested at the two-leaf stage with isolate Ptr 94-8-2 [race 3] which induces extensive chlorosis. Disease assessment was based on the presence or absence of extensive chlorosis. Absence of chlorosis [resistance] was dominant and the segregation pattern in the F(2) and F(3) generations indicated that a single gene controlled resistance. Absence of segregation in the 10 crosses among the resistant cultivars indicated that they share the same gene for resistance.

Genetics of resistance to the necrosis component of tan spot of wheat. P. K. Singh and G. R. Hughes. Department of Plant Sciences, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK S7N 5A8. Publication no. P-2000-0063-PCA.

Tan spot, a foliar disease of wheat (Triticum aestivum), is caused by the fungus Pyrenophora tritici-repentis. In recent years, it has been a major component of the leaf spot disease complex of wheat in western Canada. Since knowledge of the genetic control of resistance assists efforts to develop resistant cultivars, this study was conducted to determine the inheritance of resistance to the necrosis component of tan spot in four resistant cultivars, spring wheat cultivars Erik and 86ISWN 2137, and winter wheat cultivars Hadden and Red Chief. The resistant cultivars were crossed to two susceptible spring wheat cultivars Glenlea and Kenyon. Plants of the F(1) and F(2) generations, and F(2:3) and F(3:4) families of each cross were tested at the two-leaf stage with isolate Ptr 92-164 (race 2) which induces tan necrosis. Lesion type was used to rate plants as either resistant or susceptible. Resistance was recessive and due to a single gene in all crosses. Lack of segregation in the F(2) generation and in F(2:3) families produced from all possible crosses among the resistant cultivars indicated that Red Chief, Hadden, Erik and 86ISWN 2137 possess one resistance gene in common.

Serenade, a new biocontrol agent for powdery mildew control on hops. W. R. SLABAUGH (1) and Mitch Rohlfs (2). (1) AgraQuest, Inc., 1050 Echo Avenue, Parma, ID 83660; (2) Rohlfs Agricultural Research, 6203 Terrace Heights Drive, Yakima, WA 98901. Publication no. P-2000-0064-PCA.

Powdery mildew, caused by Sphaerotheca macularis, has become a serious disease on hops (Humulus lupulus) grown in the Pacific Northwest. Total crop failure can be experienced on susceptible varieties in the form of unmarketable cones. During the 1999-growing season, Serenade (Bacillus subtilis, strain QRD713) was compared with myclobutanil for efficacy of powdery mildew control in a hop yard on the cultivar Chelan near Sunnyside, Washington. Disease pressure was moderate in the upper canopy and high in the lower canopy. Serenade was as effective as myclobutanil. Serenade WP at 8 lbs/acre and myclobutanil at 0.6-oz active ingredient/acre provided 94 and 100 percent control, respectively, based on leaf area in the upper canopy. In summary, Serenade appears as effective as conventional fungicides but has the additional benefits of being a fungicide resistance management tool, having low environmental impact, fitting into Integrated Pest Management programs and having a short re-entry period. Additional studies are in progress to confirm these results.

Control of brown rot of sweet cherry fruit with a preharvest fungicide, a postharvest yeast, and modified atmosphere packaging. R. A. SPOTTS, L. A. Cervantes, and T. J. Facteau. Mid-Columbia Agricultural Research and Extension Center, Oregon State University, Hood River 97031. Publication no. P-2000-0065-PCA.

Sweet cherry trees cv. Lapins and Lambert were sprayed with propiconazole (Orbit 3.6E) at 0.28 kg/ha, four days before harvest or left unsprayed. One day after harvest, fruit were dipped in a suspension of Cryptococcus infirmo-miniatus strain YY6 (CIM) at 2.5 × 10(^8) CFU/ml or water, both containing Monilinia fructicola at 1.0 × 10(^4) conidia/ml. CIM was a WDG formulation produced by Ecogen, Inc. Treated fruit were stored at -0.5°C and 2.8°C in air or in modified atmosphere packaging (MAP). Disease was evaluated after 20 and 42 days at 2.8°C and -0.5°C, respectively. Preharvest propiconazole, postharvest CIM, and MAP all effectively reduced brown rot of fruit in cold storage. MAP was most effective for fruit stored at -0.5°C. Propiconazole combined with CIM reduced decay more than either treatment alone in most cases. No decay developed in Lambert or Lapins fruit that were treated only with CIM and stored 6 weeks at -0.5°C in MAP. Combining these strategies enhances the prospect for limiting loss of sweet cherry fruit to brown rot during prolonged storage.

Suppression of fire blight with mixtures of mechanistically-compatible biological control agents. V. O. Stockwell (1), L. M. Anderson (1), K. B. Johnson (1), and J. E. LOPER (2). (1) Oregon State University, Corvallis; (2) USDA-ARS, Corvallis, Oregon 97330. Publication no. P-2000-0066-PCA.

The biological control agents Pseudomonas fluorescens A506 and Pantoea agglomerans 252 suppress fire blight of pear and apple when sprayed onto blossoms during early bloom. Strain 252 suppresses fire blight through a mechanism of antibiosis: it produces an antibiotic that suppresses the fire blight pathogen, Erwinia amylovora, and was required for suppression of fire blight of pear in four field trials. Mixtures of strain 252 and A506 were rarely superior to the individual strains in suppressing fire blight in the field. We hypothesized that P. fluorescens A506 and P. agglomerans 252 were mechanistically incompatible because A506 produces an extracellular protease that detoxifies the antibiotic responsible for biological control by 252. To test this hypothesis, we obtained a protease-minus (Ecp-) mutant of A506 that no longer detoxified the antibiotic produced by 252. Mixtures of 252 and the Ecp- mutant of A506 were as effective or more effective than mixtures of 252 and A506 in suppressing fire blight in four field trials. Therefore, mechanistic compatibility between biological control agents is an important consideration for designing mixtures of antagonists for management of plant disease.

Epidemic of structural wood rot in southern California caused by Gloeophyllum. M. F. STONER. Department of Biological Sciences, California State Polytechnic University, Pomona, CA 91768. Publication no. P-2000-0067-PCA.

G. trabeum (GT) is a major cause of brown rot of exposed structural wood in North America. Heretofore in southern California GT has not been the subject of much special attention. Now, however, GT activity, populations, and resultant losses have reached epidemic levels, mostly in warm and relatively moist coastal areas. Compared to dramatically damaging Meruliporia incrassata, GT is virtually unknown to the construction and pest control industries, yet its damages are more widespread, insidious, and costly. Factors creating this epidemic include GT's characteristics (tolerance to alternate wetting and drying, pronounced longevity in dried wood, ability to reactivate quickly, compounding population, wide distribution, and tendency to rot wood from within); wood factors (increased use of "green" and/or pre-infected woods, exposure, predisposition by aging and weathering checks or splits, use of susceptible softwoods); moisture (leaks, condensation, irrigation); and other supports (termites, paints that seal in moisture, exponential increases in susceptible structures). The epidemic points to needs for complete etiology; better understanding of interactions between specific fungi with unique behaviors and their supporting environment; holistic control measures; and public education.

Molecular systematics of citrus-associated Alternaria spp. G. SU (1), T. L. Peever (1) and L. W. Timmer (2). (1) Department of Plant Pathology, Washington State University, Pullman, WA, USA; (2) University of Florida, CREC, Lake Alfred, FL, USA. Publication no. P-2000-0068-PCA.

The causal agent of Alternaria brown spot of citrus has been referred to as Alternaria citri or A. alternata. Ten new species of Alternaria were proposed recently (E.G. Simmons, Mycotaxon 70: 263-323) based on the morphology of citrus isolates collected from brown spot lesions on rough lemon (Citrus jambhiri) and tangelo (C. paradisi × C. reticulata) in six countries. None of the isolates was considered A. alternata or A. citri. In order to test these morphological species concepts using molecular data, several genomic regions of the pathogens including the 5' end of the beta-tubulin gene and mitochondrial large subunit were sequenced and compared to saprophytic isolates of A. alternata, A. solani and other known Alternaria species. Phylograms estimated from both regions gave five clades with strong bootstrap support, including one clade for the citrus brown spot isolates, saprophytic A. alternata, A. tenuissima and A. gaisen isolates; two clades for A. solani isolates; one clade for A. limicola isolates; and one clade for A. infectoria, A. brassicicola, A. arbusti and A. conjuncta isolates. These data indicate that all of the citrus isolates belong to one phylogenetic species.

Using GPS/GIS technology to study a Puccinia sp. as a biological control of dyer's woad (Isatis tinctoria). S. V. THOMSON, D. R. Hansen, and B. R. Kropp. Dept. of Biology, Utah State University, Logan, UT 84322. Publication no. P-2000-0069-PCA.

Populations of dyer's woad (Isatis tinctoria) in Utah are infected with Puccinia thlaspeos, which is spreading throughout woad infestations and may be an excellent candidate for bio-control of this noxious weed. To study the long term effects of rust on populations of dyer's woad, we are using a Trimble GeoExplorer GPS receiver to record woad population data and rust incidence and locate survey points on several rust-infested sites in two northern Utah counties. The GPS data is graphically illustrated using GIS processing. The woad population increased from 1997 to 1998 then dropped in 1999, which corresponded with a similar increase and decline in the incidence of rust in 1998 and 1999 respectively. Whether the fluctuation of dyer's woad populations are related to rust incidence is not clear, but may be revealed as we monitor these populations from year to year.

A PCR-based assay using sequenced characterized DNA markers for the identification and detection of Aphanomyces euteiches. G. J. VANDEMARK (1), J. M. Kraft (1), R. C. Larsen (1), and M. A. Gritsenko (2). (1) U.S. Department of Agriculture-Agricultural Research Service, Prosser, WA 99350; (2) Washington State University-IAREC, Prosser, WA 99350. Publication no. P-2000-0070-PCA.

PCR products were identified that were amplified only from isolates of Aphanomyces euteiches or A. cochlioides. The products were cloned and sequenced, and the data used to design pairs of extended PCR primers to amplify sequence characterized DNA markers. The primer pair OPC7-FS-30 and OPC7-RS-25 amplified a single 1332 bp product from all isolates of A. euteiches that was not amplified from any other fungal isolates tested. A single 718 bp product was selectively amplified only from all isolates of A. cochlioides using the primer pair OPB10-FS-25 and OPB10-RS-25. A. euteiches was detected in pea roots one day after inoculation with a zoospore suspension. PCR also detected A. euteiches in the organic fraction of field soil samples. Both pairs of extended primers were used in a multiplex reaction to unambiguously discriminate between A. euteiches and A. cochlioides. Both pairs of primers could be used in two-step PCR reactions in which annealing and extension was done in a single step at 72 C. This reduced the time required for amplification of the diagnostic PCR product and its resolution by electrophoresis to less than three hours. We currently are developing methods to quantify the amount of A. euteiches present in infected plant roots through the use of fluorescent detection with quantitative PCR.

Ophiostoma floccosum scytalone dehydratase gene restores the pigmentation and pathogenicity of Colletotrichum lagenarium melanin-deficient mutant. H. L. WANG, S. H. Kim, and C. Breuil. Chair of Forest Products Biotechnology, Dept. of Wood Science, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada. Publication no. P-2000-0071-PCA.

O. floccosum is one of the major sapstain fungi reducing the value of lumber and logs due to wood discoloration. The black pigment produced by O. floccosum was identified as melanin. To control the pigmentation on wood, it is necessary to understand the melanin biosynthetic pathway in this fungus Preliminary works on melanin inhibition by tricyclazole suggested that this fungus is likely to use the DHN pathway. Thus, we cloned a dehydratase gene encoding a key enzyme of DHN melanin biosynthetic pathway from O. floccosum using degenerated oligonucleotide primers and PCR approach. We sequence 1.5 kb of nucleotides from a genomic phage clone containing 6.5 kb insert. DNA database searches showed that the determined sequence shared high sequence identities with other fungal scytalone dehydratase. An open reading frame of 651 nucleotides was found to encode a putative protein of 261 amino acids. Two introns were found in the gene. To verify the function of the cloned gene, we complemented the C. lagenarium mutant 9201Y defective in scytalone dehydratase activity with the O. floccosum gene. Melanin production and pathogenicity to cucumber leaves were restored in the complemented mutant. Consequently, we concluded that O. floccosum use the DHN pathway to synthesize its melanin.

Pycnidia produced by Phaeoacremonium chlamydosporum on grape wood in culture. E. C. WHITING, W. D. Gubler, and D. M. Rizzo. Dept. of Plant Pathology, University of California, Davis 95616. Publication no. P-2000-0072-PCA.

Decline of young grapevines was first reported in major production regions of California in 1994. Phaeoacremonium spp., associated often with declining vines, cause dark streaking in vascular tissues of roots, root crown and spurs. The fungus is classified as a hyphomycete. However, we have produced pycnidia of P. chlamydosporum on grape wood in culture. Autoclaved cane wood shavings were inoculated with P. chlamydosporum and pycnidia formed after one month. Pycnidia were dark, complete, superficial, and were separate or sometimes grouped. They were globose to subglobose, or broadly ellipsoidal, and were 113-190 microns(um)in diameter. After two months, a white spore mass was visible as ooze on several pycnidia. Conidial dimensions, based on 50 spores, ranged from (2)2.5-3(3.5)by(x)1-2 microns(um). Conidia were hyaline, subglobose to oblong in shape, and were consistent with sizes reported for conidia of P. chlamydosporum, i.e. (1.5)3-4(4.5)by(x)1-1.5(2)microns(um). Colony morphology from germinated conidia was similar to P. chlamydosporum. This finding is important in the biology and taxonomy of the fungus, as well as in understanding inoculum dispersal.

Assessment of Swiss needle cast disease development: I. Comparison of biochemical, molecular, and visual methods to quantify Phaeocryptopus gaeumannii in Douglas-fir needles. L. M. WINTON (1), D. K. Manter (2), E. M. Hansen (1), and J. K. Stone (1). (1) Department of Botany and Plant Pathology, (2) Forest Science Department, Oregon State University, Corvallis OR 97331. Publication no. P-2000-0073-PCA.

Swiss needle cast is a defoliating disease caused by Phaeocryptopus gaeumannii that has been shown to be associated with growth loss of Douglas-fir. A recent epidemic along the Oregon Coast has prompted efforts to quantify P. gaeumannii colonization of foliage. Direct observation of fruiting body abundance on needle surfaces has proven to be well correlated with needle retention but is laborious. Recent advances in technology have suggested biochemical and molecular methods that may provide an indirect means of estimating fungal biomass within host tissue. In this report we compare four methods to quantify infection levels of P. gaeumannii: fruiting body density, ergosterol content, DNA probe hybridization, and Taqman quantitative PCR. While all four techniques were significantly correlated, fruiting body density and quantitative PCR, the two methods unaffected by the presence of other needle fungi, had the greatest correlation (r =. 76). In addition, we compared nine field plots having a range of disease severity using all four methods. Each method provided overwhelming evidence that the sites differed in fungal colonization. However, only fruiting body density and quantitative PCR consistently separated the worst from intermediate sites as previously estimated by needle retention and growth measurements.

Cultivar resistance in relation to distribution of scald barley caused by Rhynchosporium secalis in Alberta. K. Xi (1), T. K. Turkington (2), J. H. Helm (1), K. B. Briggs (3), J. P.Tewari (3), and P. D. Kharbanda (4). (1) Alberta Agriculture, 6000 C & E Trail, Lacombe, AB T4L 1W1; (2) Agriculture and Agri-Food Canada, Lacombe Research Centre, 6000 C & E Trail, Lacombe, AB T4L 1W1; (3) Dept of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5; (4) Alberta Research Council, Vegreville, AB T9C 1T4. Publication no. P-2000-0074-PCA.

Commercial barley cultivars and differentials with varying levels of scald resistance were evaluated for scald reaction from 1997 to 1999 at various locations in Alberta. The Rh gene in cv. Hudson, Rh2 in Atlas and Atlas 46, and Rh9 in Abyssinian and Kitchin were resistant at all locations and years, and can be used as sources of resistance by Western Canadian breeding programs. Cultivars Modoc and Trebi were intermediate in reaction to scald and, thus, the Rh4(^2) and rh6 genes in these two differentials may not represent effective sources of resistance. Scald reaction of commercial cultivars was significantly different among locations, suggesting a more complicated genetic basis of resistance in commercial cultivars compared with the differentials. The resistance in commercial cultivars AC Stacey, CDC Dolly, Kasota and Seebe held up at most locations. Resistant cultivars CDC Guardian and CDC Earl became increasingly susceptible at Calmar, Lacombe and Trochu. Cluster analyses over years and locations showed that disease reactions of 33 commercial cultivars were divided into five groups. Each group tended to include the same locations over different years, suggesting an uneven distribution of scald pathotypes in Alberta. Consequently, scald management via the choice of cultivar may be location dependent.

Molecular detection of Stenocarpella maydis in maize. Z. Xia and P. N. Achar. Department of Microbiology, University of Durban-Westville, Private Bag X 54001, Durban 4000. zxia@pixie.udw.ac.za & pachar@pixie.udw.ac.za. Publication no. P-2000-0075-PCA.

Stenocarpella maydis (Berk.) Sutton is the most prevalent ear rot pathogen of South African maize (Zea mays). Ear rot is a major disease affecting the successful cultivation of maize, since it directly influences yield, grade and price of final product. The genetic relationship of 34 isolates of S. maydis from different geographic regions in S. Africa was analyzed by random amplified polymorphic DNA (RAPD) and ribosomal DNA markers. The two genetic groups were found by using 3 UBC primers and correlated to cultural morphology of isolates. Of all the isolates tested, 79.4% were clustered into RAPD Group (RG I), those isolates did not sporulate on PDA at 25°C for 10 days. The remaining isolates designated the RAPD group II (RG II), which sporulated on PDA at 25°C for 10 days when compared to RG I. Coupled with RFLP of PCR products, two distinct genetic groups exist among S. maydis isolates from South African maize. Ribosomal DNA (rDNA) was amplified using PCR with the universal primers internal transcribed spacer (ITS) 1 and ITS 4. ITS regions of rDNA were sequenced. PCR products were subjected to sequence directly or cloned with PCR cloning kit (Stratagene) before sequencing. The sequence of ITS region are similar to that of Phomopsis spp. with approximately 80-90% similarity. S. maydis specific primers have been designed. The sequences of the P1 and P2 primers are GTTGGGGGTTTAACGGCACG and GTTGCCTCGGCACAGGCCGG, respectively. The primer pair P1 / P2 permitted a sensitive and S. maydis specific detection and thus can be for routine detection in maize seeds.

Identification of Phytophthora spp. in irrigation water in the Wenatchee River Valley. F. YAMAK (1), T. L. Peever (1), and G. G. Grove (2). (1) Department of Plant Pathology, Washington State University, Pullman,WA; (2) Tree Fruit Research and Extension Center, Washington State University, Wenatchee,WA. Publication no. P-2000-0076-PCA.

Phytophthora spp. which contaminate irrigation water in Eastern Washington cause sprinkler rot of apple and pears. Water from four canals was sampled for Phytophthora spp. in Wenatchee in 1999 using pears as bait. Among the 197 isolates obtained, only 37% produced oospores or sporangia but could not be identified to species. Fifteen morphologically distinct isolates were chosen for molecular analyses. ITS1, 5.8S, and ITS2 regions of rDNA were amplified by PCR and digested with three restriction enzymes. Restriction digestion patterns were compared among these isolates and with ten known Phytophthora spp. Seven different restriction patterns were observed among the selected isolates and patterns did not fit with that of the known species. ITS regions of 11 isolates, chosen based on restriction pattern and morphology, were sequenced and variation was observed among them. PCR amplification, restriction digestion and sequencing of ITS will be performed for all of the sampled isolates to facilitate their identification.