Barley Growing Instructions

Obtaining OWB seeds​

Seeds of the OWB-ISS can be obtained from Dr. Pat Hayes at Oregon State University (https://barleyworld.org/owb; https://barleyworld.org/main/plant-material) or Dr. Roger Wise USDA-ARS at Iowa State University. Contact Greg Fuerst, USDA-ARS Corn Insects and Crop Genetics Research Unit, Department of Plant Pathology, Entomology, and Microbiology, 1344 Advanced Teaching and Research Building, 2213 Pammel Drive, Iowa State University, Ames, IA, 50011.​

Growing Barley Plants

Barley needs 6-8 weeks to grow and mature to the point where its traits are easily identifiable to students (see Growing Instructions for OWB). You can plant your “phenotype plants" two months prior to beginning the module and students determine if the genotype matches the phenotype observed, or you can plant them at the same time you plant your “genotype plants" so students can predict the phenotype according to their results of the genotype analysis. Instructors should plant the “genotype plant" about 8-10 days prior to the module. These week-old plants will provide the plant tissue that students use to extract DNA as part of an ecology or plant anatomy unit. The more ownership the students have in the module, the more engaged they are in the investigation of genotype and phenotype.​

Growing Instructions for OWB

Containers: In general, the larger the pot, the larger the plant. You will obtain a good grow-out with 13 cm (5-in.) pots. When the plants become larger, a dowel rod or bamboo plant stake and twist ties or other support will be needed to hold the stalks up right. For this set of experiments, instructors need at least 20 pots for plants to be grown to maturity and examined to determine phenotype, and one tray (with a minimum of 20 cells or seedling containers) for DNA extraction.

Soil: Use a peat moss mix that will drain well. Barley is less tolerant of acid than most plants. If you have reason to believe your soil is acidic, have it tested and adjust the pH to 7.0 with lime.

Seeding: Prepare your containers with soil and sow 1-3 seeds per pot at a depth of approximately 2.5 cm (one inch). Lightly compact the soil over the seeds and water without causing the seed to float to the top. Seedlings should emerge within one week.

Fertility: If your soil mix does not already contain time-release fertilizer, fertilize with a dilute solution of liquid fertilizer, such as Rapid Grow or Peters (20-20-20). The plants should be fertilized once per week starting when the plant reaches two leaves of growth, and then fertilized twice per week when the plants start flowering. Continue at this rate until the plants start to dry down.

Watering: Barley is less tolerant of over-watering than under-watering. Treat your OWBs like houseplants, watering when the surface of the soil is moist but not dry to the touch. It is better to water infrequently but generously (until water flows through drain holes at the bottom of the pot) than to water lightly at frequent intervals.

Propagation conditions: Provide supplemental lighting for 16 hours per day. Fluorescent lights will work, but they should be numerous and no further than 1.5 m (5 feet) from the canopy surface. Sufficient light quantity and quality are essential.

Culture: The OWBs will show a stunning array of plant growth and development patterns. The first plants will head within 30 days of planting and the last will head at about 90 days. Plant height at heading can range from 40 to 120 cm (16 to 48 in.). Taller plants may require supplemental support. Use bamboo or dowel stakes and wire ties.

*Modified from https://barleyworld.org/​

​Instructor Guidelines: Experiment 1: Molecular Analysis of the Kap genetic Locus

Time Frame and Supplies

Kap Activity 1: DNA Extraction and Purification (Activity Time: Three 45 Minute Classes or Two 90 Minute Classes)

Day One: Harvest Plant Tissue

1. Before class, add 400 µl 2-Mercaptoethanol to 19.6 ml of 2x CTAB = 20 ml total. This should be done in a fume hood.
2. Aliquot 805 µl of the 2-Mercaptoethanol and CTAB solution into 20 x 1.5 ml microcentrifuge tubes labeled CTAB-2Mercap for students.
3. Aliquot 105 µl of SDS into 20 x 1.5 ml microcentrifuge tubes labeled SDS for students.
   

Day Two: Extract DNA

1. Before class, set up water bath at 65˚C.
2. Aliquot 415 µl of the Potassium Acetate into 20 - 1.5 ml microcentrifuge tubes labeled PA for students. This must be kept cold.
3. Aliquot 545 µl Absolute Isopropanol into 20 - 1.5 ml microcentrifuge tubes labeled AI for students. This must be kept cold.
4. Have styrofoam cups and crushed ice ready.
5. While incubating, students will collect the cup, ice, and potassium acetate tube and absolute isopropanol tube.
6. While centrifuging, have students label new 2.0 ml microcentrifuge tubes.
7. Pipetting the supernatant without getting any green plant material can be difficult. Be prepared to centrifuge tubes several times to help students get the 1 ml of supernatant needed.
   

End of Day Notes:

• Make sure each tube is properly labeled as the students give them to you. The permanent marker can often get rubbed off.
• Store these samples overnight at 4˚C or freeze for longer storage.
  

Day Three: Purification of DNA (This can be done on Day 2 if you have 90 minute periods)

Before Class:

1. Aliquot 505 µl of 70 % ethanol into 20 - 1.5 ml microcentrifuge tubes labeled E for students. This must be kept cold.
2. Aliquot 205 µl of TE Buffer into 20 - 1.5 ml microcentrifuge tubes labeled TE for students.
   

End of Day Notes:

• Make sure each tube is properly labeled as the students give them to you. The permanent marker can often get rubbed off.
• Store these samples overnight at 4˚C or freeze for longer storage.
• Source: Protocol modified from Keb-Llanes et al., Plant Molecular Biology Reporter 20: 299a-299e. 2002.​
  

Kap Activity 2: Polymerase Chain Reaction of the Kap Gene [Activity Time: 15 Minutes Plus Cycling Time (105 minutes)]

PCR Polymerase and Tube Options

You have two options; Taq DNA polymerase with Master Mix, or, some instructors have found Taq DNA Polymerase beads to be easier in a classroom setting. Both of these protocols use 0.2 mL centrifuge tubes.

1. For regular 0.2 ml PCR Tubes (No beads) Protocol: Taq DNA Polymerase, & Master Mix.
2. For PCR Tubes with Taq Beads Protocol: 0.2 ml PCR Tubes with Taq DNA Polymerase Beads.
   

Using Regular Taq Polymerase PCR (use with regular tubes)

1. Create primer mix in a 1.5 ml centrifuge tube by adding enough Master Mix, water,Kap primers, and Taq polymerase for all reactions (plus two to compensate for pipetting error). See Table 2 for determining primer mix amounts.
2. Add the Taq polymerase to the primer mix just before students come to get the 24 µl. Taq must be kept cold to prevent degradation.
   

Using Taq DNA Polymerase Beads

1. Create primer mix in a 1.5 ml centrifuge tube by adding enough water and Kap primers for all reactions (plus two to compensate for pipetting error). See chart below for determining primer mix amounts.
   

Preparing Samples for PCR

Cycling Parameters

• Step 1: 94˚C for 3 minutes
• Step 2: 94˚C for 30 seconds, 54˚C for 30 seconds, 72˚C for 1 min 30 sec (35x)
• Step 3: 72˚C for 10 minutes
• Step 4: 4˚C for ∞ (hold forever)

The thermal cycler program has a run time of over two hours. Take that into careful consideration when planning for multiple classes running the module.

End of Day Notes

• Make sure each tube is properly labeled as the students give them to you. The permanent marker can often get rubbed off.
• Once the samples have run the program, store them at 4˚C with the DNA samples.
  

Primer Information

Kap = 3BF  CCCCTCAAAGTTCAGGTCAATCCT  24 bp
3DR  ATAAAACCAGAAGAGTGTGGAGTA  24 bp

• Reference for Kap primers: Williams-Carrier, R., Lie, Y., Hake, S., and Lemaux, P. (1997). Ectopic expression of the maize kn1 gene phenocopies the Hooded mutant of barley. Development. 124: 3737-3745.
• Primers can be ordered through Invitrogen or any other supplier of oligonucleotides.
• PCR Beads: GE Healthcare illustra™ PureTaq™ Ready-To-Go™ PCR Beads
• Store @ Room Temperature
  
  

Kap Activity 3: Using Gel Electrophoresis to Analyze PCR Products (Activity Time: 45 Minutes)

Preparing the Gel

1. First, determine the volume of the gel to be used. This will depend on the length and width of the gel tray, as well as the approximate depth of the gel you want. Multiply the gel volume by 0.01 to determine the number of grams of agarose needed for a 1% gel. Using this module, an 80 ml gel will require 0.8 grams of agarose.
   
   Note: The 1% gel can be somewhat flimsy. If you want to make a “stiffer" gel, make a 1.5- 2% gel. It will take longer to run Electrophoresis, but it is easier to move around between storage and viewing. Just double the amount of agarose used (2%) or add 1.5x (1.5%).*
   
   
2. In an Erlenmeyer flask, add your calculated amount of agarose to a volume of 1X TBE buffer equal to the desired gel volume. So, using the example from above of 1%, you would measure out 0.8 g of agarose and 80 ml of 1X TBE and pour them both in the flask. (You may get a stock solution of 10X TBE Buffer. In this case, you must dilute this 1X TBE. You can do this by adding 10ml of the 10X TBE to 90 ml of distilled water.)
   
   
3. Dissolve the agarose using a microwave oven. Use 45-60 second intervals, gently swirling in-between each interval, but be careful not to create bubbles, as this will interfere with pouring of the gel. When solution is clear, the agarose is dissolved.
   
   
4. Let the flask stand on the tabletop until it is warm (but not below 55˚C because the gel will start to solidify). A good indicator is if you can touch the bottom of the flask for several seconds without your hand getting too hot. While you are waiting for the solution to cool, tape the ends of the gel tray with labeling tape or masking tape.
   
   
5. Add 1 µl of GelGreen stain for every 10 ml of buffer used. Again, using our example, the 80 ml of 1X TBE we used in Step 2 would require 8 µl of GelGreen. The GelGreen will dissolve quickly simply by swirling the contents of the flask.
   
   
6. Make sure the 2 x 20-well gel comb(s) is (are) inserted into the gel box. Now pour the agarose solution into the gel tray. Let it stand until the solution completely cools and becomes semi-solid. A good indicator that the gel is ready is if you notice it has become a whitish-cloudy color.
   
   
7. Remove the combs and tape from the gel tray before placing into the gel box. Pour 1X TBE into the gel box until both reservoirs are full and the gel is slightly submerged (about 1 mm over the top of the gel).
   
   Note: The TBE buffer in the chamber can be reused multiple times throughout this module.*
   
   
8. Prepare a class sheet that maps out the wells in the gel so that students can mark where they put their DNA sample. (a simple example is below)
   
   

 If you have time, you can run this during class and visualize the gel before the period ends. If you don't have enough time, you can run the gel, wrap it in plastic wrap or put it in a sealed plastic bag with a little bit of buffer to keep it moist and store it in the refrigerator. The cool temperature will prevent the DNA bands from diffusing throughout the gel becoming difficult to see. (runs at ~3 volts/centimeter)

It is important to note: DNA is negatively charged, so it will run from the negative end of the box (black electrode) to the positive end of the box (red electrode). The saying “Run to red" helps to remember.​

​Instructor Guidelines: Experiment 2: Restriction Length Polymorphisms and the Vrs1gene

Time Frame and Supplies

Overview

In this activity, the barley DNA samples are amplified by Polymerase Chain Reaction using Vrs1 primers, then the PCR products are cut with Ncil (a restriction endonuclease that cuts the dominant (two-row) allele in 3 places and the recessive (six-row) allele in two places. This PCR amplification, along with the electrophoresis of the PCR products, allows us to see the DNA difference between barley plants that have a two-row seed spike and those that have a six-row seed spike.

Students will plant seeds and sample tissues from two-row and six-row plants following the same instructions for the Kap gene analysis (Hooded vs awned). They will purify the DNA using the same 3-day procedure they used for the Kap gene. Depending on time constraints, students can plant seeds, harvest tissues, and purify DNA for both experiments at the same time, taking care to clearly label each test-tube and sample, as working with multiple samples simultaneously requires clear and consistent documentation and care to not mix tubes when completing the bench work.​

Vrs Activity 1: PCR of the Vrs1 gene [Activity Time: 15 Minutes Plus Cycling Time (105 minutes)]

Instructor Preparation – Regular Taq Polymerase PCR

1. Create primer mix in a 1.5 ml centrifuge tube by adding enough Master Mix, water, Vrs1 primers, and Taq polymerase for all reactions (plus two to compensate for pipetting error).
2. Add the Taq polymerase to the primer mix just before students come to get the 24 µl. Taq must be kept cold to prevent degradation.​
   
   

Preparing Samples for PCR

Cycling Parameters

• Step 1: 94˚C for 3 minutes
• Step 2: 94˚C for 30 seconds, 60˚C for 30 seconds, 72˚C for 1 min 30 sec (35x)
• Step 3: 72˚C for 10 minutes
• Step 4: 4˚C for ∞ (hold forever)

The thermal cycler program has a run time of over two hours. Take that into careful consideration when planning for multiple classes running the module. ***Note the annealing temperature is different than the Kap gene protocol.***

End of Day Notes

• Make sure each tube is properly labeled as the students give them to you. The permanent marker can often get rubbed off.
• Once the samples have run the program (again, note the difference in annealing temperatures of the cycle parameters), store them at 4 ˚C with the DNA samples.
• Students will run a gel electrophoresis of the Vrs1 PCR product in the next section while the digest is occurring.
  

Primer Information

Vrs1 = HvHox1.01F  CCGATCACCTTCACATCTCC  20 bp
HvHox1.02R  GGTTTCTGCCGATCTTGAAGC  21 bp

• Reference for Vrs1 primers: Komatsuda, T., Pourkheirandish, M., He, C., Azhaguvel, P., Kanamori, H., Perovic, D., Stein, N., Graner, A., Wicker, T., Tagiri, A., Lundqvist, U., Fujimura, T., Matsuoka, M., Matsumoto, T., and Yano, M. (2007). Six-rowed barley originated from a mutation in a homeodomain-leucine zipper I-class homeobox gene. Proc. Natl. Acad. Sci. USA. 104: 1424-1429.
• PCR Beads: GE Healthcare illustra™ PureTaq™ Ready-To-Go™ PCR Beads (Store @ Room Temperature)​
  

Vrs Activity 2: Restriction Digest of the Vrs1 Gene Product [Activity Time: 15 Minutes Plus Digest Time (1 Hour)]

Instructor Preparation – Vrs1 Digest

1. Create a reaction mix of NEB Buffer 4, Ncil, and H₂0 in a 1.5 ml centrifuge tube (see table below). Keep on ice until ready to transfer 5 µl to each student's tube. Note: rCutSmart^™ Buffer can also be used.
   
   

Note: Total reaction mix is 5 µl, and total template DNA (PCR Products) is 20 µl = 25 µl total.​

Vrs Activity 3: Using Gel Electrophoresis to Analyze Digest Products (Activity Time: 45 Minutes)

Instructor Preparation – Vrs1 Digest Product Gel Electrophoresis:

Make a gel using the same instructions from Gel Electrophoresis of Kap gene and fill the chamber with electrophoresis buffer before students add samples.

​Instructor Guidelines: Experiment #3: Investigating alleles that influence disease resistance inOWB

Time Frame and Supplies

Overview

There are two possible primer sets to use for this experiment: conserved region primers and divergent region primers. Using the conserved primers will yield a gel electrophoresis pattern with identical bands for each plant. Using the divergent primers will show different bands between the resistant and susceptible plants. If the experiment is run with both primer sets, students can compare the results and use their observations to inform discussions about gene structure. If this is beyond the scope of the instructor's course goals, the experiment should be run with just the divergent primers because these are the primers that will distinguish resistant and susceptible (S) plants.

We provide pictures of each of the resistant and susceptible OW​B-ISS individuals in Figure 11, such that participants can connect the phenotypes to genotype deduced by PCR and gel electrophoresis. However, due to APHIS permit restrictions, we cannot supply the actual pathogen for students to inoculate with powdery mildew.​ Click here for the instructor version of Figure 11​.

1. Create primer mix in a 1.5 ml centrifuge tube by adding enough Master Mix, water,Mla primers, and Taq polymerase for all reactions (plus two to compensate for pipetting error). See chart below for determining primer mix amounts.
2. Add the Taq polymerase to the primer mix just before students come to get the 24 µl. Taq must be kept cold to prevent degradation.
   
   

 Instructor preparation: PCR Beads

1. Create primer mix in a 1.5 ml centrifuge tube by adding enough water and Mla primers for all reactions (plus two to compensate for pipetting error).
    

 Make sure each tube is properly labeled as the students give them to you. The permanent marker can often get rubbed off. Once the samples have run the program, store them at 4˚C with the DNA samples.

Preparing Samples for PCR

Cycling Parameters

• Step 1: 94˚C for 3 minutes
• Step 2: 94˚C for 30 seconds, 59˚C for 30 seconds, 72˚C for 1 min 30 sec (35x)
• Step 3: 72˚C for 10 minutes
• Step 4: 4˚C for ∞ (hold forever)
  

The thermal cycler program has a run time of over two hours. Take that into careful consideration when planning for multiple classes running the module.

Primer Information

Divergent Forward: 5' AAGGAATTGCCGTCCACAGT 3'

Divergent Reverse: 5' CACTGGCAGGACTAAGTCGG 3'

Conserved Forward: 5' AGAATCAGTTGTGATCAGTCTGGGCG 3'

Conserved Reverse: 5' CCGGAGATGGTCGGGATGAG 3'

• PCR Beads: GE Healthcare illustra™ PureTaq™ Ready-To-Go™ PCR Beads, and Store @ Room temperature
  

Mla6 gene regions

​​​​​ Figure 12. Comparison of different regions of the Mla gene. A, Conserved region of the Mla gene. The DNA sequences of multiple Mla alleles are lined up. B, Divergent region of the Mla gene.​

In contrast, the second set of primers was designed to target a divergent region of DNA. Divergent regions are more common towards the 3' end. Figure 12B shows a region of DNA in which there are dozens of differences in base pairs between the seven aligned alleles. Because there are significant differences between the sequences, when PCR is completed with divergent primers, only Mla6 is amplified and only Mla6 shows a band on the gel.​

Mla Activity 2: Using Gel Electrophoresis to Analyze PCR Products (Activity Time: 45 Minutes)

Make a gel using the same instructions from Gel Electrophoresis of the Kap gene and fill the chamber with electrophoresis buffer before students add samples.​

​​Overview

​​Experiment 1​​​Experiment 2Experiment 3
​​AppendixGlossary​​​