In August 2010, yellow mosaic and leaf deformation were observed on leaves of field planted ornamental pumpkin (Cucurbita pepo L. convar. microcarpina Grebenščikov) plants near Tasovice Village in the Znojmo District of the Czech Republic. These symptoms were typical of a virus infection. Nine leaf samples were collected and examined for the presence of commonly occurring cucurbit viruses by double-antibody sandwich (DAS)-ELISA. Eight samples were infected with Zucchini yellow mosaic virus (ZYMV), seven with Watermelon mosaic virus-2 (WMV-2), five with Cucumber mosaic virus (CMV), and two with Squash mosaic virus (SqMV). Some aphid species were observed on inspected plants but we did not carried out a search for vectors. SqMV isolates, Tas-1 and Tas-5, were also infected with ZYMV and WMV-2. SqMV was separated from the other viruses by mechanical inoculation onto the resistant plant species Cucumis sativus L. ‘Taichung Mou Gua-1’, which is resistant to ZYMV and WMV-2 (3). The virus was transmitted back to C. pepo plants, and DAS-ELISA used for testing for multiple viruses proved the presence of SqMV alone. A C. pepo leaf sample was examined by electron microscopy to validate the presence of the virus. Isometric particles of approximately 30 nm in diameter, corresponding in size and shape to the described particles of SqMV (2), were observed. The presence of SqMV was verified by reverse transcription (RT)-PCR using specific primers designed on the sequence for coat proteins of SqMV found in NCBI and EMBL databases (SqMV-F: TGTGTACAAGATTGGTGGAGATGC; SqMV-R: AGGCTTCTAAAGCGAACTGGG). The obtained amplicons of approximately 1,900 bp were sequenced (GenBank Accession No. JF922966), and by using nucleotide blast analysis (4), identified as a part of RNA-2 genome. Blast analysis showed that the Czech SqMV isolates, Tas-1 and Tas-5, were identical and similar to published SqMV sequences from the United States, Japan, and China. The highest similarity was found between the Czech isolates and one isolate from the United States (Accession No. M96148; E = 0, nucleotide sequence identity = 90%) and one from China (Accession No. AF059533; E = 0, nucleotide sequence identity = 90%). To our knowledge, this is the first report of a natural occurrence of SqMV in the Czech Republic. SqMV can be transmitted via infected seeds by as much as 35% (1); therefore, protection against epidemics should be based on clean seed programs.
References: (1) M. Alvarez et al. Phytopathology 68:257, 1978. (2) H. M. Mazzone et al. Biochim. Biophys. Acta 55:164, 1962. (3) T. Wai et al. J. Hered. 88:454, 1997. (4) Z. Zhang et al. J. Comput. Biol. 7:203, 2000.
