In the early spring of 2011 and 2012, severe necrotic leaf symptoms were observed on freesia (Freesia refracta, family Iridaceae) in several greenhouses around Plovdiv (south central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados, and Pink Fountain) led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions that coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35 to 40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of ~10 plants each and analyzed for Freesia sneak virus (3) (FreSV, Ophiovirus, Ophioviridae) infection by RT-PCR. A generic Ophiovirus RT-PCR (4) yielded the diagnostic 136-bp product, while primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA3; GenBank DQ885455), specifically amplified a 466 bp fragment. This FreSV-specific fragment was amplified from all samples, pooled, purified, and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity to that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. FreSV RNA3 (about 1.5 kbp) was also detected by northern blotting using a specific Digoxigenin-DNA probe (PCR-DIG Probe Synthesis Kit, Roche) amplified with primers FOV1/2. Due to severe symptoms present on freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia (1), so diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae), and Potyvirus genus (4) were used in RT-PCR assays with random-primed cDNA from infected freesias as the template. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was described in freesia in The Netherlands before 1970, as well as in England and Germany; FreSV is a putative agent of freesia leaf necrosis, being reported in strong association with the disease in Italy, The Netherlands, the United States, and New Zealand, and also infects Lachenalia hyb. (Hyacinthaceae) (2,3,4). However, additional unidentified synergistic viral agents cannot be ruled out and must be identified to aid control of soilborne severe leaf necrosis syndrome. The vector of FreSV, Olpidium brassicae, may persist in soil for years (3). To our knowledge, this is the first report of FreSV on F. refracta in Bulgaria; identifying the disease and vector may allow growers to implement preventive control measures to reduce economic damage.
References: (1) A. A. Brunt. In: Virus and Virus-Like Diseases of Flower Crops, pp. 274-280, Wiley, 1995. (2) M. N. Pearson et al. Austr. Plant Path. 38:305, 2009. (3) A. M. Vaira and R. G Milne. In: Encyclopedia of Virology, III ed., vol. 3, pp. 447-454, Elsevier, 2008. (4) A. M. Vaira et al. Plant Dis. 93:965, 2009.
