Okra, Abelmoschus esculentus L., is a popular vegetable grown in Iraq. Three pathogens have been identified as causal agents of damping-off of okra in Iraq: Pythium spp., Rhizoctonia solani, and Fusarium solani (1). In California and Brazil, Phytophthora nicotianae has also been reported as a pathogen of okra (2). P. nicotianae can cause significant damage when soils are cool to warm (20 to 30°C) and wet. Damping-off is now considered one of the most important and destructive diseases of okra in Iraq with disease incidence reaching 50 to 75% in some fields. In March and April 2012, symptoms of damping-off were observed in two okra fields of ~0.75 and 1.50 ha located north and south of Baghdad, Iraq, respectively. The symptoms included dark brown lesions that coalesced, girdling the stem at the base, and causing seedling collapse within a few days. Symptomatic tissues were surface-sterilized in 1% NaOCl for 1 min and plated on potato dextrose agar (PDA). Emerging fungal colonies were transferred to new plates of PDA and incubated at 25°C. P. nicotianae was identified by morphological and molecular techniques. Spherical, bipapillate sporangia had a mean length of 48 μm, mean width of 40 μm, and 1.0 to 1.4:1.0 ratio of length to breadth with 40-μm-long chlamydospores. Oospores and antheridia were not observed when two isolates were grown on PDA or in water. Swelling and radiating hyphae developed in water culture. No hyphal growth was observed on PDA when the culture was incubated at 35°C. These morphological and cultural characteristics were similar to those reported by van Breda de Haan (4) concerning P. nicotianae. The identification of two isolates was confirmed by sequencing the internal transcribed spacer (ITS) region of rDNA using forward and reverse primers (ITS1: I1, TCCGTAGGTGAACCTGCGG; and ITS4: I4, TCCTCCGCTTATTGATATGC, respectively) at the BCCM/LMG Microbiology Collection Laboratory for Microbiology, University of Ghent, Belgium (MUCL 54380). The ITS rDNA consensus sequence for the two isolates showed 99% identity with the ITS sequences of known P. nicotianae isolates, and was deposited in GenBank. Pathogenicity tests of one of the isolates of P. nicotianae were performed on okra seedlings of a local cultivar grown in a 1:1 mixture of sterile soil and peat moss in pots (each 5 cm tall × 10 cm wide). The soil peat mix in each pot was infested with a half PDA plate of fungal growth (7 days old), from which the mycelium and agar were homogenized and added to the soil. A half PDA plate without P. nicotianae was added to potting mix for the non-inoculated treatment. Ten okra seeds were sown in each pot and three pots were used for each treatment. Plants were irrigated as needed with sterilized water, and maintained in a greenhouse at 25 ± 2°C with 100% relative humidity for 48 h by covering the pots with polyethylene bag. Thereafter, the bags were removed and the pots kept in the greenhouse at ambient relative humidity (approximately 50%) for 5 days. Inoculated plants showed seed decay and damping-off after 7 days, whereas control plants remained healthy. The pathogen reisolated from inoculated seedling had the same morphological and molecular (ITS rDNA) characteristics as described above.
References: (1) A. J. Al Ashoor. Ph.D. Thesis, University of Koofa, Iraq, 2009. (2) D. C. Erwin. Phytopathology 54:114, 1964. (3) D. S. M. Maria et al. Summa Phytopatológica 29:193, 2003. (4) C. Waterhouse. Key to the Species of Phytophthora De Bary. Comm. Mycol. Papers No. 92, 1963.
