Authors
S. M. K. Widana Gamage, Department of Botany, University of Ruhuna, Matara, Sri Lanka, and Laboratory of Virology, Wageningen University, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands; and
A. Hassani-Mehraban and
D. Peters, Laboratory of Virology, Wageningen University, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands
Leek (Allium porrum) has become one of the major leafy vegetable export crops in Sri Lanka during last few years. This year-round crop is cultivated in open fields at elevations between 1,000 and 2,000 m on approximately 1,600 ha with a production of 27,000 t per year (2). In August 2009, straw-colored spots (2 to 3 mm in diameter), surrounded by a greenish halo and a necrotic area, resembling symptoms to those caused by Iris yellow spot virus (IYSV) were observed on leek in Kandapola in the Nuwara Eliya District. Additional thrips damage consisting of silver-colored spots was observed on all plants. IYSV (family Bunyaviridae, genus Tospovirus) was first described and characterized in the Netherlands in 1998 (1). During the last few years, this virus was reported from Australia, Brazil, Chile, France, Germany, Guatemala, India, Israel, New Zealand, Peru, Reunion Island, Serbia, South Africa, Spain, the United States (4), and Japan. Collected samples were initially analyzed for IYSV infections using antisera raised against nucleocapsid (N) protein in a double-antibody sandwich (DAS)-ELISA. The presence of IYSV was confirmed by a reverse transcription (RT)-PCR using IYSV-F-373 (5′CTGCGGGCTTCTCTGG3′) and IYSV-R-779 (5′GACTCACCAATGTCTTCAAC3′) primers that amplify a 400-bp fragment of the N gene. The entire N gene was not obtained when specific primers were used to retrieve the complete N gene. Four nucleotides of the reverse primer GAAAGATAGATATAATTAA (indicated in bold) did not match with sequence at the 3′end of the N gene. Hence, to obtain the remaining parts of the N gene, the primers UHP (5′CACTGGATCCTTTTGTTTTTGTTTTTTG3′) and Asian Termini (5′CCCGGATCCAGAGCAATCGAGGY3′) (3) were combined with IYSV-F and IYSV-R. The obtained amplicons were cloned into pGEM-T easy vector and sequenced. The N gene sequence has been deposited at the NCBI/GenBank (Accession No. GU901211). The deduced N protein sequence(s) were compared with other IYSV N protein sequences available in the GenBank and showed a 92% protein identity with the Brazilian strain (IYSV-BR) and 97% with the Dutch strain (IYSV-NL) with Accession Nos. AAF04199 and AAB61923, respectively. No data on the thrips vector species or on the disease incidence have been collected. The presence of IYSV in Sri Lanka can potentially be considered as a threat for the export of leek. To our knowledge, this is the first report that IYSV occurs in Sri Lanka.
References: (1) I. Cortêz et al. Phytopathology 88:1276, 1998. (2) Department of Census and Statistics Sri Lanka. Retrieved from http://www.statistics.gov.lk, 2009. (3) A. Hassani-Mehraban et al. Phytopathology 95:852, 2005. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.
